Transcript: Human NM_001367389.1

Homo sapiens lysine methyltransferase 5A (KMT5A), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
KMT5A (387893)
Length:
2573
CDS:
189..923

Additional Resources:

NCBI RefSeq record:
NM_001367389.1
NBCI Gene record:
KMT5A (387893)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001367389.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359372 TTGAACAGATGGCCTTATATT pLKO_005 1111 3UTR 100% 15.000 21.000 N KMT5A n/a
2 TRCN0000359303 CACCCGTGGCTGAAGCATTAA pLKO_005 903 CDS 100% 13.200 18.480 N KMT5A n/a
3 TRCN0000148268 GTTTCCTGAAACTGGGTTAAT pLKO.1 1635 3UTR 100% 13.200 18.480 N KMT5A n/a
4 TRCN0000130036 GAATCGCAAACTTACGGATTT pLKO.1 395 CDS 100% 10.800 15.120 N KMT5A n/a
5 TRCN0000359304 CCGAGGAACAGAAGATCAAAG pLKO_005 196 CDS 100% 10.800 8.640 N KMT5A n/a
6 TRCN0000130139 CGCAACAGAATCGCAAACTTA pLKO.1 388 CDS 100% 5.625 4.500 N KMT5A n/a
7 TRCN0000359373 GCCTAGGAAGACTGATCAATC pLKO_005 739 CDS 100% 10.800 7.560 N KMT5A n/a
8 TRCN0000149455 GAAACCATTAGCCGGAATCTA pLKO.1 119 5UTR 100% 5.625 3.938 N KMT5A n/a
9 TRCN0000128082 CAAAGGACAAAGTGCCCTCAA pLKO.1 965 3UTR 100% 4.050 2.835 N KMT5A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001367389.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10090 pDONR223 99.7% 69.2% 69% None 0_1ins324;623C>G n/a
2 TRCN0000469703 CTAATGACGTGGACCACCAACCCG pLX_317 46.1% 69.2% 69% V5 0_1ins324;623C>G n/a
3 ccsbBroad304_10090 pLX_304 62.4% 69.1% 10.7% V5 (not translated due to prior stop codon) 0_1ins324;108delT;623C>G n/a
Download CSV