Transcript: Human NM_001367555.1

Homo sapiens nudix hydrolase 1 (NUDT1), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
NUDT1 (4521)
Length:
752
CDS:
44..397

Additional Resources:

NCBI RefSeq record:
NM_001367555.1
NBCI Gene record:
NUDT1 (4521)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001367555.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050130 CCCGACGACAGCTACTGGTTT pLKO.1 489 3UTR 100% 1.650 2.310 N NUDT1 n/a
2 TRCN0000288946 CCCGACGACAGCTACTGGTTT pLKO_005 489 3UTR 100% 1.650 2.310 N NUDT1 n/a
3 TRCN0000050132 CGAGTTCTCCTGGGCATGAAA pLKO.1 92 CDS 100% 5.625 3.938 N NUDT1 n/a
4 TRCN0000306995 CGAGTTCTCCTGGGCATGAAA pLKO_005 92 CDS 100% 5.625 3.938 N NUDT1 n/a
5 TRCN0000050131 CCTGAGCTCATGGACGTGCAT pLKO.1 275 CDS 100% 0.880 0.616 N NUDT1 n/a
6 TRCN0000288947 CCTGAGCTCATGGACGTGCAT pLKO_005 275 CDS 100% 0.880 0.616 N NUDT1 n/a
7 TRCN0000050129 CCTGCTTCAGAAGAAGAAATT pLKO.1 515 3UTR 100% 13.200 7.920 N NUDT1 n/a
8 TRCN0000288945 CCTGCTTCAGAAGAAGAAATT pLKO_005 515 3UTR 100% 13.200 7.920 N NUDT1 n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 415 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 415 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001367555.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01047 pDONR223 100% 70.9% 63.7% None (many diffs) n/a
2 ccsbBroad304_01047 pLX_304 0% 70.9% 63.7% V5 (many diffs) n/a
3 TRCN0000492162 GATGTCGTGGGCACATTGCCTGAG pLX_317 76.1% 70.9% 63.7% V5 (many diffs) n/a
4 ccsbBroadEn_01046 pDONR223 100% 61.9% 55.7% None (many diffs) n/a
5 ccsbBroad304_01046 pLX_304 0% 61.9% 55.7% V5 (many diffs) n/a
6 TRCN0000468026 GCGGTGTGAGGCCTTATGTCGGAT pLX_317 78% 61.9% 55.7% V5 (many diffs) n/a
Download CSV