Transcript: Human NM_001367567.1

Homo sapiens palladin, cytoskeletal associated protein (PALLD), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
PALLD (23022)
Length:
3695
CDS:
235..1434

Additional Resources:

NCBI RefSeq record:
NM_001367567.1
NBCI Gene record:
PALLD (23022)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001367567.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073467 CCGAGGTTAACATACGAAGAA pLKO.1 211 5UTR 100% 4.950 6.930 N PALLD n/a
2 TRCN0000296445 CGTTTACATTTCTCGACATTA pLKO_005 1413 CDS 100% 13.200 10.560 N PALLD n/a
3 TRCN0000073463 GCTCTGAATAAAGCAGAAATA pLKO.1 2354 3UTR 100% 13.200 9.240 N PALLD n/a
4 TRCN0000289995 GCTCTGAATAAAGCAGAAATA pLKO_005 2354 3UTR 100% 13.200 9.240 N PALLD n/a
5 TRCN0000306642 AGCCAAAGATCTATTGGTTTA pLKO_005 527 CDS 100% 10.800 7.560 N Palld n/a
6 TRCN0000296447 AGTTGTACTGGACGGCTAATG pLKO_005 694 CDS 100% 10.800 7.560 N PALLD n/a
7 TRCN0000073464 GCCAAGAATGAAGCAGGGATT pLKO.1 1369 CDS 100% 4.050 2.430 N PALLD n/a
8 TRCN0000090755 GCCGGCATCTACACATGTATT pLKO.1 1048 CDS 100% 13.200 18.480 N Palld n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001367567.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02713 pDONR223 100% 36% 36% None 0_1ins2121 n/a
2 ccsbBroad304_02713 pLX_304 0% 36% 36% V5 0_1ins2121 n/a
3 TRCN0000481534 GAATCCATCTCAACTATATTATTT pLX_317 14% 36% 36% V5 0_1ins2121 n/a
Download CSV