Transcript: Human NM_001367603.1

Homo sapiens Rap guanine nucleotide exchange factor 5 (RAPGEF5), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
RAPGEF5 (9771)
Length:
1663
CDS:
85..831

Additional Resources:

NCBI RefSeq record:
NM_001367603.1
NBCI Gene record:
RAPGEF5 (9771)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001367603.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047404 CGTCACACTGTAGATGAATAT pLKO.1 697 CDS 100% 13.200 18.480 N RAPGEF5 n/a
2 TRCN0000431202 GTTCCGCGTAGGAAACGTAAA pLKO_005 502 CDS 100% 10.800 15.120 N RAPGEF5 n/a
3 TRCN0000047403 GCTAAGAAGTATCAAGGCAAA pLKO.1 466 CDS 100% 4.050 3.240 N RAPGEF5 n/a
4 TRCN0000047405 CCTACCTTCGATGTGCCTTAT pLKO.1 172 CDS 100% 10.800 7.560 N RAPGEF5 n/a
5 TRCN0000047407 CCTCATTTGGAGAGGAAAGAT pLKO.1 115 CDS 100% 5.625 3.375 N RAPGEF5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001367603.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11412 pDONR223 100% 55.6% 54.9% None (many diffs) n/a
2 ccsbBroad304_11412 pLX_304 0% 55.6% 54.9% V5 (many diffs) n/a
3 TRCN0000478426 GGGAGGCTCAGTTTGATGTATATC pLX_317 23.5% 55.6% 54.9% V5 (many diffs) n/a
Download CSV