Transcript: Human NM_001367956.1

Homo sapiens family with sequence similarity 170 member A (FAM170A), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
FAM170A (340069)
Length:
1379
CDS:
212..1204

Additional Resources:

NCBI RefSeq record:
NM_001367956.1
NBCI Gene record:
FAM170A (340069)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001367956.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263468 TCGTCCTATTCATCCTATAAG pLKO_005 524 CDS 100% 13.200 18.480 N FAM170A n/a
2 TRCN0000263469 ATACTACATGCAGGTACAAAT pLKO_005 595 CDS 100% 13.200 9.240 N FAM170A n/a
3 TRCN0000263466 AGTTACTTCTACCTCCGAATA pLKO_005 361 CDS 100% 10.800 7.560 N FAM170A n/a
4 TRCN0000263467 TCTGATGTGTCCACCAGAAAC pLKO_005 731 CDS 100% 10.800 7.560 N FAM170A n/a
5 TRCN0000263470 ACAGGCTGCCCAAGGTATGAA pLKO_005 1288 3UTR 100% 5.625 3.938 N FAM170A n/a
6 TRCN0000150135 GAAACTTTGGAGTCCTTAGAA pLKO.1 650 CDS 100% 5.625 3.938 N FAM170A n/a
7 TRCN0000183821 CCTATTCATCCTATAAGACTT pLKO.1 528 CDS 100% 4.950 2.970 N FAM170A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001367956.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10021 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_10021 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000476896 CTGGACAGAACCAAAGTATGAAGC pLX_317 38.8% 100% 100% V5 n/a
Download CSV