Transcript: Human NM_001368065.1

Homo sapiens LIM domain binding 3 (LDB3), transcript variant 9, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
LDB3 (11155)
Length:
5174
CDS:
84..2078

Additional Resources:

NCBI RefSeq record:
NM_001368065.1
NBCI Gene record:
LDB3 (11155)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001368065.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245663 TCTCACTTGAGCACGATATTT pLKO_005 3561 3UTR 100% 15.000 21.000 N LDB3 n/a
2 TRCN0000146379 CCAAAGCGATACACTTGCTTT pLKO.1 2380 3UTR 100% 0.495 0.693 N LDB3 n/a
3 TRCN0000245662 AGGAGGGAGCCTCCCTATTAA pLKO_005 767 CDS 100% 15.000 10.500 N LDB3 n/a
4 TRCN0000245661 GAGCCAGCCGAGGCAATATAA pLKO_005 650 CDS 100% 15.000 10.500 N LDB3 n/a
5 TRCN0000245665 GTTTACTGTGAGCGATGTTAT pLKO_005 1680 CDS 100% 13.200 9.240 N LDB3 n/a
6 TRCN0000245664 TCTGCGGTCACTGCAACAATG pLKO_005 1543 CDS 100% 10.800 7.560 N LDB3 n/a
7 TRCN0000147241 GCAAACAAATTGAAGTGCCAA pLKO.1 2479 3UTR 100% 2.640 1.848 N LDB3 n/a
8 TRCN0000147688 GCGATGTTATGAGCAATTCTT pLKO.1 1691 CDS 100% 5.625 3.375 N LDB3 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4156 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001368065.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07762 pDONR223 100% 36.9% 30.8% None (many diffs) n/a
2 ccsbBroad304_07762 pLX_304 0% 36.9% 30.8% V5 (many diffs) n/a
3 TRCN0000472162 TCCCTGTATGCGACTCTTCCCAAT pLX_317 57.1% 36.9% 30.8% V5 (many diffs) n/a
Download CSV