Transcript: Human NM_001368116.1

Homo sapiens CNKSR family member 3 (CNKSR3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
CNKSR3 (154043)
Length:
3049
CDS:
309..1994

Additional Resources:

NCBI RefSeq record:
NM_001368116.1
NBCI Gene record:
CNKSR3 (154043)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001368116.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438728 GATGCCCTTTGCCGGTATTTC pLKO_005 1701 CDS 100% 13.200 18.480 N CNKSR3 n/a
2 TRCN0000439887 AGCGGATTCCTCCGATCATTG pLKO_005 1729 CDS 100% 10.800 15.120 N CNKSR3 n/a
3 TRCN0000037835 CGGAGTTGTGTTACTGCTTAA pLKO.1 1175 CDS 100% 10.800 15.120 N CNKSR3 n/a
4 TRCN0000430086 GTATTATGTAGGGACCTTATG pLKO_005 2081 3UTR 100% 10.800 15.120 N CNKSR3 n/a
5 TRCN0000037837 CACTGAATTATGGCCTCGAAA pLKO.1 538 CDS 100% 4.950 6.930 N CNKSR3 n/a
6 TRCN0000414663 ATGATGGGTTACACGTGATTA pLKO_005 1018 CDS 100% 13.200 9.240 N CNKSR3 n/a
7 TRCN0000416987 TAGCGGAAATGGAGGATAAAG pLKO_005 844 CDS 100% 13.200 9.240 N CNKSR3 n/a
8 TRCN0000417232 TGACGAAGTCATTCAAGTTAA pLKO_005 1091 CDS 100% 13.200 9.240 N CNKSR3 n/a
9 TRCN0000441072 GAAAGCCGGAGACGAAGATTC pLKO_005 1497 CDS 100% 10.800 7.560 N CNKSR3 n/a
10 TRCN0000037838 AGGTGCTACATCAACTCAGAT pLKO.1 1836 CDS 100% 4.950 3.465 N CNKSR3 n/a
11 TRCN0000037834 CCTGCAACAATATGTCCACAA pLKO.1 392 CDS 100% 4.050 2.835 N CNKSR3 n/a
12 TRCN0000037836 GCCATCCTGGATCTTTATATT pLKO.1 1344 CDS 100% 15.000 9.000 N CNKSR3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001368116.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09705 pDONR223 100% 96.9% 96.2% None (many diffs) n/a
2 ccsbBroad304_09705 pLX_304 0% 96.9% 96.2% V5 (many diffs) n/a
3 TRCN0000467888 ATGGTCTCAACACTATACTAAACG pLX_317 23.9% 96.9% 96.2% V5 (many diffs) n/a
Download CSV