Transcript: Human NM_001368138.1

Homo sapiens myosin VI (MYO6), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
MYO6 (4646)
Length:
8531
CDS:
233..4006

Additional Resources:

NCBI RefSeq record:
NM_001368138.1
NBCI Gene record:
MYO6 (4646)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001368138.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219876 TAGTGGGAATACTGGATATTT pLKO.1 1782 CDS 100% 15.000 21.000 N MYO6 n/a
2 TRCN0000219877 GTGAATCCAGAGATAAGTTTA pLKO.1 2046 CDS 100% 13.200 10.560 N MYO6 n/a
3 TRCN0000333031 GTGAATCCAGAGATAAGTTTA pLKO_005 2046 CDS 100% 13.200 10.560 N MYO6 n/a
4 TRCN0000168004 CCCTACAGATGGATTTCAGAT pLKO.1 265 CDS 100% 4.950 3.960 N MYO6 n/a
5 TRCN0000344624 CCCTACAGATGGATTTCAGAT pLKO_005 265 CDS 100% 4.950 3.960 N MYO6 n/a
6 TRCN0000167285 CCAGATTTAACCATTCCATAA pLKO.1 4070 3UTR 100% 10.800 7.560 N MYO6 n/a
7 TRCN0000344626 CCAGATTTAACCATTCCATAA pLKO_005 4070 3UTR 100% 10.800 7.560 N MYO6 n/a
8 TRCN0000167152 CCATCAATACTTCTTGTGATA pLKO.1 3411 CDS 100% 4.950 3.465 N MYO6 n/a
9 TRCN0000344625 CCATCAATACTTCTTGTGATA pLKO_005 3411 CDS 100% 4.950 3.465 N MYO6 n/a
10 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 7927 3UTR 100% 4.950 2.475 Y ORAI2 n/a
11 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 7851 3UTR 100% 4.950 2.475 Y ERAP2 n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 7852 3UTR 100% 13.200 6.600 Y LIAS n/a
13 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 7924 3UTR 100% 4.950 2.475 Y LOC339059 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001368138.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01058 pDONR223 100% 97.8% 97.8% None 551_552insAGCTAACCCACTCCT;3090_3091ins69 n/a
2 ccsbBroad304_01058 pLX_304 0% 97.8% 97.8% V5 551_552insAGCTAACCCACTCCT;3090_3091ins69 n/a
3 TRCN0000479334 CACGAGCCTCTGTTGTAATCAACC pLX_317 10.9% 97.8% 97.8% V5 551_552insAGCTAACCCACTCCT;3090_3091ins69 n/a
Download CSV