Transcript: Human NM_001369112.1

Homo sapiens activating signal cointegrator 1 complex subunit 1 (ASCC1), transcript variant 33, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
ASCC1 (51008)
Length:
2273
CDS:
104..862

Additional Resources:

NCBI RefSeq record:
NM_001369112.1
NBCI Gene record:
ASCC1 (51008)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001369112.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418084 AGAATTGATGGCCGGAATTAC pLKO_005 131 CDS 100% 13.200 18.480 N ASCC1 n/a
2 TRCN0000429066 TGCACAGTTCAGTAACGTTAA pLKO_005 1270 3UTR 100% 10.800 7.560 N ASCC1 n/a
3 TRCN0000135802 CAAGAACAGACCTATCAACAT pLKO.1 167 CDS 100% 4.950 3.465 N ASCC1 n/a
4 TRCN0000136952 CTATTGGGATGTTGGTGCTTT pLKO.1 645 CDS 100% 4.950 3.465 N ASCC1 n/a
5 TRCN0000135961 GAAAGAGTGGAATAGTGTGAA pLKO.1 787 CDS 100% 4.950 3.465 N ASCC1 n/a
6 TRCN0000136268 GCTTCATCTAACTATTGGGAT pLKO.1 634 CDS 100% 2.640 1.848 N ASCC1 n/a
7 TRCN0000137029 CCTCAATGAAGTTGAGGTTCA pLKO.1 523 CDS 100% 0.405 0.284 N ASCC1 n/a
8 TRCN0000136016 GAAGATGAAGAGGACTTCTAT pLKO.1 191 CDS 100% 5.625 3.375 N ASCC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001369112.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03168 pDONR223 100% 70.3% 69.7% None 626_627ins120;752T>C;755_756delTTins197 n/a
2 ccsbBroad304_03168 pLX_304 0% 70.3% 69.7% V5 626_627ins120;752T>C;755_756delTTins197 n/a
3 TRCN0000472778 GGTTATAGAGAGTGTTGGTATGTT pLX_317 46.1% 70.3% 69.7% V5 626_627ins120;752T>C;755_756delTTins197 n/a
Download CSV