Transcript: Human NM_001369489.1

Homo sapiens ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1 (ARAP1), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
ARAP1 (116985)
Length:
4897
CDS:
718..4302

Additional Resources:

NCBI RefSeq record:
NM_001369489.1
NBCI Gene record:
ARAP1 (116985)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001369489.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047836 CCGCAGGGATCTTACATCTAT pLKO.1 997 CDS 100% 5.625 7.875 N ARAP1 n/a
2 TRCN0000047837 CGATCGCTACTTCATCCTCAA pLKO.1 3882 CDS 100% 4.050 5.670 N ARAP1 n/a
3 TRCN0000047833 CCTGCGATACTTTGACAGTAA pLKO.1 1050 CDS 100% 4.950 3.960 N ARAP1 n/a
4 TRCN0000428992 CATGAGTGGGTCAAGTGTATT pLKO_005 2497 CDS 100% 13.200 9.240 N ARAP1 n/a
5 TRCN0000433585 ACTTCATCTGCACAGTGTATC pLKO_005 3500 CDS 100% 10.800 7.560 N ARAP1 n/a
6 TRCN0000418757 CACTTATCGAGCTCTTCTTAC pLKO_005 1781 CDS 100% 10.800 7.560 N ARAP1 n/a
7 TRCN0000438499 GAGAACGGCTGTACCTGTTTG pLKO_005 2453 CDS 100% 10.800 7.560 N ARAP1 n/a
8 TRCN0000438169 GCTGGAGAGATGGGCATAAGT pLKO_005 4579 3UTR 100% 5.625 3.938 N ARAP1 n/a
9 TRCN0000047834 CATGGCTTTGAGCACACCTTT pLKO.1 2416 CDS 100% 4.950 3.465 N ARAP1 n/a
10 TRCN0000047835 GTGGCCTATTAAGAGTCTCAA pLKO.1 3957 CDS 100% 4.950 3.465 N ARAP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001369489.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09439 pDONR223 100% 94.8% 94.8% None 181C>T;1073_1255del;2040G>A n/a
2 ccsbBroad304_09439 pLX_304 0% 94.8% 94.8% V5 181C>T;1073_1255del;2040G>A n/a
3 TRCN0000480589 AAATAACGGCTCGCGCACATTAAT pLX_317 10.6% 94.8% 94.8% V5 181C>T;1073_1255del;2040G>A n/a
Download CSV