Transcript: Human NM_001369524.1

Homo sapiens eva-1 homolog A, regulator of programmed cell death (EVA1A), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
EVA1A (84141)
Length:
1969
CDS:
593..1051

Additional Resources:

NCBI RefSeq record:
NM_001369524.1
NBCI Gene record:
EVA1A (84141)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001369524.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130440 GAGCCTGAATCGCTACTATTA pLKO.1 1030 CDS 100% 13.200 18.480 N EVA1A n/a
2 TRCN0000376540 AGCGAGCAGCTCTGTACTTTG pLKO_005 687 CDS 100% 10.800 15.120 N EVA1A n/a
3 TRCN0000377382 AGCGCATCATCAGGGAGATCT pLKO_005 975 CDS 100% 4.950 6.930 N EVA1A n/a
4 TRCN0000365031 GCAACATCCTAGCGGCCTATT pLKO_005 645 CDS 100% 10.800 8.640 N EVA1A n/a
5 TRCN0000370070 GAACCCAGCTCTGCTAATATT pLKO_005 1130 3UTR 100% 15.000 10.500 N EVA1A n/a
6 TRCN0000365032 GTGGATGGAGATCGGAGAAAC pLKO_005 1300 3UTR 100% 10.800 7.560 N EVA1A n/a
7 TRCN0000128937 CGACTGTGGTTTCTCTTGATT pLKO.1 1322 3UTR 100% 5.625 3.938 N EVA1A n/a
8 TRCN0000130421 GAGCAGCTCTGTACTTTGTTT pLKO.1 690 CDS 100% 5.625 3.938 N EVA1A n/a
9 TRCN0000128634 CCTATTCCTTTGTCTCAGAAA pLKO.1 660 CDS 100% 4.950 3.465 N EVA1A n/a
10 TRCN0000370071 CTCTGGTGATAAGGATCTCTT pLKO_005 747 CDS 100% 4.950 3.465 N EVA1A n/a
11 TRCN0000130835 GATGGCTTTGCTCAGCAACAT pLKO.1 631 CDS 100% 4.950 3.465 N EVA1A n/a
12 TRCN0000127819 GCAGGGTGAACTTAACCCAAT pLKO.1 1434 3UTR 100% 4.050 2.835 N EVA1A n/a
13 TRCN0000130634 CTTTGTTTCTGGCGTGTGCAT pLKO.1 703 CDS 100% 2.640 1.848 N EVA1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001369524.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04335 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04335 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469416 AATACAAAACTCCCATCACTTGAC pLX_317 95.3% 100% 100% V5 n/a
Download CSV