Transcript: Human NM_001369699.1

Homo sapiens NFKB inhibitor beta (NFKBIB), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
NFKBIB (4793)
Length:
2263
CDS:
65..1081

Additional Resources:

NCBI RefSeq record:
NM_001369699.1
NBCI Gene record:
NFKBIB (4793)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001369699.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018558 GAATACGACGACATTGTGGTT pLKO.1 2108 3UTR 100% 2.640 3.696 N NFKBIB n/a
2 TRCN0000275156 TACTCCCGACACCAACCATAC pLKO_005 568 CDS 100% 6.000 4.800 N NFKBIB n/a
3 TRCN0000018557 GTGGCCGTTATCCACAAAGAT pLKO.1 701 CDS 100% 5.625 3.938 N NFKBIB n/a
4 TRCN0000018556 GCTGTGATTCATCAGCATGAA pLKO.1 257 CDS 100% 0.495 0.347 N NFKBIB n/a
5 TRCN0000275102 GCTGTGATTCATCAGCATGAA pLKO_005 257 CDS 100% 0.495 0.347 N NFKBIB n/a
6 TRCN0000018559 CGACTTGGAGAAGGAAGAAGA pLKO.1 613 CDS 100% 4.950 2.970 N NFKBIB n/a
7 TRCN0000318914 CGACTTGGAGAAGGAAGAAGA pLKO_005 613 CDS 100% 4.950 2.970 N NFKBIB n/a
8 TRCN0000275155 AGATGCTGGAGCTGACCTTGA pLKO_005 745 CDS 100% 4.050 2.430 N NFKBIB n/a
9 TRCN0000275104 TGGACCTGCAGAATGACCTAG pLKO_005 324 CDS 100% 4.050 2.430 N NFKBIB n/a
10 TRCN0000018560 GCAGCCGATGTGCTGGAGCTT pLKO.1 821 CDS 100% 0.000 0.000 N NFKBIB n/a
11 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 1652 3UTR 100% 4.950 2.475 Y ERAP2 n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1653 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001369699.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01094 pDONR223 100% 92.1% 91.5% None (many diffs) n/a
2 ccsbBroad304_01094 pLX_304 53% 92.1% 91.5% V5 (many diffs) n/a
3 TRCN0000471386 TAAACTCTGGATCGGATTACCTCC pLX_317 45.1% 92.1% 91.5% V5 (many diffs) n/a
Download CSV