Transcript: Human NM_001369752.1

Homo sapiens small nuclear ribonucleoprotein D2 polypeptide (SNRPD2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
SNRPD2 (6633)
Length:
541
CDS:
66..302

Additional Resources:

NCBI RefSeq record:
NM_001369752.1
NBCI Gene record:
SNRPD2 (6633)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001369752.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074399 GCCGCGTGAAGGCCTTCGATA pLKO.1 226 CDS 100% 0.000 0.000 N SNRPD2 n/a
2 TRCN0000074400 CATCAACTGCCGCAACAATAA pLKO.1 194 CDS 100% 13.200 9.240 N SNRPD2 n/a
3 TRCN0000301102 CATCAACTGCCGCAACAATAA pLKO_005 194 CDS 100% 13.200 9.240 N SNRPD2 n/a
4 TRCN0000074401 GCTCACACAGTCAGTCAAGAA pLKO.1 158 CDS 100% 4.950 3.465 N SNRPD2 n/a
5 TRCN0000301033 GCTCACACAGTCAGTCAAGAA pLKO_005 158 CDS 100% 4.950 3.465 N SNRPD2 n/a
6 TRCN0000231021 TGCTCACACAGTCAGTCAAGA pLKO_005 157 CDS 100% 4.950 3.465 N SNRPD2P1 n/a
7 TRCN0000074398 CCGCTACATCTCCAAGATGTT pLKO.1 370 3UTR 100% 0.495 0.347 N SNRPD2 n/a
8 TRCN0000301103 CCGCTACATCTCCAAGATGTT pLKO_005 370 3UTR 100% 0.495 0.347 N SNRPD2 n/a
9 TRCN0000305243 AGGAGATGTGGACTGAGGTTC pLKO_005 303 CDS 100% 4.050 2.430 N Snrpd2 n/a
10 TRCN0000112029 ACTGCAACATGGTGCTGGAAA pLKO.1 276 CDS 100% 4.950 2.475 Y Snrpd2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001369752.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01571 pDONR223 100% 54.7% 45.5% None 181_206del;234_235ins146 n/a
2 ccsbBroad304_01571 pLX_304 0% 54.7% 45.5% V5 181_206del;234_235ins146 n/a
3 TRCN0000478535 GGTGTACGTTAGAAACCGGCCGGG pLX_317 95.7% 54.7% 45.5% V5 181_206del;234_235ins146 n/a
Download CSV