Transcript: Human NM_001369784.1

Homo sapiens myeloid leukemia factor 1 (MLF1), transcript variant 10, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
MLF1 (4291)
Length:
2241
CDS:
256..987

Additional Resources:

NCBI RefSeq record:
NM_001369784.1
NBCI Gene record:
MLF1 (4291)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001369784.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000308088 GACCGAGCTCATGTCATTAAA pLKO_005 664 CDS 100% 15.000 21.000 N MLF1 n/a
2 TRCN0000118858 CCTCAACAAAGTCCAGCCATT pLKO.1 889 CDS 100% 4.050 5.670 N MLF1 n/a
3 TRCN0000296168 GGTAGAGGGAGAGCTCATAAT pLKO_005 319 CDS 100% 13.200 10.560 N MLF1 n/a
4 TRCN0000118857 GCCATGCATTTGATTTGTTTA pLKO.1 991 3UTR 100% 13.200 9.240 N MLF1 n/a
5 TRCN0000289181 GCCATGCATTTGATTTGTTTA pLKO_005 991 3UTR 100% 13.200 9.240 N MLF1 n/a
6 TRCN0000118859 CCATTCTTGCACACCGAGAAA pLKO.1 233 5UTR 100% 4.950 3.465 N MLF1 n/a
7 TRCN0000307036 CCATTCTTGCACACCGAGAAA pLKO_005 233 5UTR 100% 4.950 3.465 N MLF1 n/a
8 TRCN0000118860 GACACAATCTAGGAAACACTA pLKO.1 809 CDS 100% 4.950 3.465 N MLF1 n/a
9 TRCN0000307038 GACACAATCTAGGAAACACTA pLKO_005 809 CDS 100% 4.950 3.465 N MLF1 n/a
10 TRCN0000118861 GCCATTGAACATGGAAGGAGA pLKO.1 904 CDS 100% 2.640 1.848 N MLF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001369784.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01018 pDONR223 100% 90.6% 90.6% None 0_1ins75 n/a
2 ccsbBroad304_01018 pLX_304 0% 90.6% 90.6% V5 0_1ins75 n/a
3 TRCN0000468189 TCCCATAAAGTCGTAACTTTACTC pLX_317 35.1% 90.6% 90.6% V5 0_1ins75 n/a
Download CSV