Transcript: Human NM_001370215.1

Homo sapiens zinc finger protein 71 (ZNF71), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
ZNF71 (58491)
Length:
3558
CDS:
180..1829

Additional Resources:

NCBI RefSeq record:
NM_001370215.1
NBCI Gene record:
ZNF71 (58491)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001370215.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417936 AGCTTGTCACCATCTGCATTT pLKO_005 2253 3UTR 100% 10.800 8.640 N ZNF71 n/a
2 TRCN0000417220 ACCCGCATGTCATGAACTGAA pLKO_005 575 CDS 100% 4.950 3.465 N ZNF71 n/a
3 TRCN0000017733 CGGGAAGTCCTTCATCAAGAA pLKO.1 1688 CDS 100% 4.950 3.465 N ZNF71 n/a
4 TRCN0000017735 GAAGACAAGCTCTCCGTTGTT pLKO.1 393 CDS 100% 4.950 3.465 N ZNF71 n/a
5 TRCN0000426075 AGAGTGGGAGCCATTGGGAAT pLKO_005 521 CDS 100% 4.050 2.835 N ZNF71 n/a
6 TRCN0000017734 GCAAGAACTTCTCCAGCACTT pLKO.1 682 CDS 100% 4.050 2.835 N ZNF71 n/a
7 TRCN0000017736 CCTGATAAAGCACCAAAGGAT pLKO.1 791 CDS 100% 3.000 2.100 N ZNF71 n/a
8 TRCN0000017737 GCGCTTCCACATCGGCGTGAA pLKO.1 1394 CDS 100% 0.000 0.000 N ZNF71 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001370215.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08779 pDONR223 100% 89% 89% None 1_180del;1116G>T n/a
2 ccsbBroad304_08779 pLX_304 0% 89% 89% V5 1_180del;1116G>T n/a
3 TRCN0000471106 TAGTCCCGGGCCCATATGCATACC pLX_317 33.8% 89% 89% V5 1_180del;1116G>T n/a
Download CSV