Transcript: Human NM_001370524.1

Homo sapiens transmembrane inner ear (TMIE), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
TMIE (259236)
Length:
2417
CDS:
908..1219

Additional Resources:

NCBI RefSeq record:
NM_001370524.1
NBCI Gene record:
TMIE (259236)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001370524.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083526 GCCATCAAAGTAGAGGAGGAT pLKO.1 1160 CDS 100% 2.640 3.696 N TMIE n/a
2 TRCN0000083525 CCCAGGAGAGGATAAGAAGAA pLKO.1 1102 CDS 100% 4.950 3.465 N TMIE n/a
3 TRCN0000124531 GCTCTTCGTGTTGTCCATCAT pLKO.1 940 CDS 100% 4.950 3.465 N Tmie n/a
4 TRCN0000083527 GCAGCGAAAGGCAGCCAAGAT pLKO.1 1030 CDS 100% 1.650 1.155 N TMIE n/a
5 TRCN0000083523 CCTCTTGGGAATCAGAGTATA pLKO.1 2010 3UTR 100% 13.200 7.920 N TMIE n/a
6 TRCN0000083524 AGGAGAGGATAAGAAGAAGAA pLKO.1 1105 CDS 100% 4.950 2.970 N TMIE n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001370524.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13487 pDONR223 100% 65.3% 65.3% None 0_1ins159;208_210delAAG n/a
2 ccsbBroad304_13487 pLX_304 0% 65.3% 65.3% V5 0_1ins159;208_210delAAG n/a
3 TRCN0000479846 GAATGACCACGAACGTCGTGGGAA pLX_317 71.9% 65.3% 65.3% V5 0_1ins159;208_210delAAG n/a
Download CSV