Transcript: Human NM_001370552.1

Homo sapiens CD200 receptor 1 like (CD200R1L), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
CD200R1L (344807)
Length:
1463
CDS:
457..1209

Additional Resources:

NCBI RefSeq record:
NM_001370552.1
NBCI Gene record:
CD200R1L (344807)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001370552.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000162133 CAACAAGAGTCTGTCCGTAAA pLKO.1 1041 CDS 100% 10.800 15.120 N CD200R1L n/a
2 TRCN0000160804 CAAGAGTCTGTCCGTAAAGTT pLKO.1 1044 CDS 100% 5.625 7.875 N CD200R1L n/a
3 TRCN0000159628 GAGGATAAATCATGTCAGAAA pLKO.1 1179 CDS 100% 4.950 6.930 N CD200R1L n/a
4 TRCN0000158704 GTCCTTACTGATCATTCTTTA pLKO.1 1101 CDS 100% 13.200 9.240 N CD200R1L n/a
5 TRCN0000160120 CCATGGATGATGTTAAGGATA pLKO.1 1300 3UTR 100% 4.950 3.465 N CD200R1L n/a
6 TRCN0000166049 GCAACAAGAGTCTGTCCGTAA pLKO.1 1040 CDS 100% 4.050 2.835 N CD200R1L n/a
7 TRCN0000161461 GCCATGGATGATGTTAAGGAT pLKO.1 1299 3UTR 100% 3.000 2.100 N CD200R1L n/a
8 TRCN0000161689 GAAGAAGGAAGGGTCTTCTTT pLKO.1 1211 3UTR 100% 0.563 0.394 N CD200R1L n/a
9 TRCN0000061144 GCCTACAAGAAAGAAACAAAT pLKO.1 631 CDS 100% 13.200 6.600 Y CD200R1 n/a
10 TRCN0000159609 GCCTACAAGAAAGAAACAAAT pLKO.1 631 CDS 100% 13.200 6.600 Y CD200R1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001370552.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04873 pDONR223 100% 62% 51.6% None (many diffs) n/a
2 ccsbBroad304_04873 pLX_304 0% 62% 51.6% V5 (many diffs) n/a
3 TRCN0000477514 CGACCTGAAACTGACTGTGTTTGC pLX_317 42.6% 62% 51.6% V5 (many diffs) n/a
Download CSV