Transcript: Human NM_001370736.1

Homo sapiens transmembrane and coiled-coil domains 5A (TMCO5A), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-05-24
Taxon:
Homo sapiens (human)
Gene:
TMCO5A (145942)
Length:
1192
CDS:
99..1007

Additional Resources:

NCBI RefSeq record:
NM_001370736.1
NBCI Gene record:
TMCO5A (145942)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001370736.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000137886 CCAGATCTCCTCGTCAATGTA pLKO.1 891 CDS 100% 5.625 7.875 N TMCO5A n/a
2 TRCN0000136525 CGCAGAGAATAGATGAAGCAA pLKO.1 211 CDS 100% 3.000 2.400 N TMCO5A n/a
3 TRCN0000416847 AGATCAAGCCCTCTACATAAA pLKO_005 623 CDS 100% 13.200 9.240 N TMCO5A n/a
4 TRCN0000135249 CCAGACTTGAAAGGAAGAATA pLKO.1 397 CDS 100% 13.200 9.240 N TMCO5A n/a
5 TRCN0000431042 GATAACCAATTGTGAACAAAG pLKO_005 476 CDS 100% 10.800 7.560 N TMCO5A n/a
6 TRCN0000416811 AGTACCAGGAAACGTTGAAGA pLKO_005 646 CDS 100% 4.950 3.465 N TMCO5A n/a
7 TRCN0000136413 CTCAAGGTAATGAAGGAGTAT pLKO.1 579 CDS 100% 4.950 3.465 N TMCO5A n/a
8 TRCN0000135763 CCTAAGAAATATCCTTGAGCA pLKO.1 1011 3UTR 100% 2.640 1.848 N TMCO5A n/a
9 TRCN0000138807 GCAATAGAAGGGAAGTGGGAT pLKO.1 1029 3UTR 100% 2.640 1.848 N TMCO5A n/a
10 TRCN0000137990 GAGGCTGGAAAGTGAGATCAT pLKO.1 278 CDS 100% 4.950 2.970 N TMCO5A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001370736.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04979 pDONR223 100% 95.2% 95.3% None 1_42del;135T>C n/a
2 ccsbBroad304_04979 pLX_304 0% 95.2% 95.3% V5 1_42del;135T>C n/a
Download CSV