Transcript: Human NM_001371100.1

Homo sapiens RNA polymerase II subunit J (POLR2J), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
POLR2J (5439)
Length:
847
CDS:
63..326

Additional Resources:

NCBI RefSeq record:
NM_001371100.1
NBCI Gene record:
POLR2J (5439)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001371100.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021871 GAGCGCTTTCGGGTGGCCATA pLKO.1 279 CDS 100% 0.000 0.000 N POLR2J n/a
2 TRCN0000021872 AGACAAGCAGGAAGGAATTGA pLKO.1 302 CDS 100% 5.625 3.375 N POLR2J n/a
3 TRCN0000426974 TGCTATTTGCTGGCTACAAAG pLKO_005 139 CDS 100% 10.800 5.400 Y POLR2J2 n/a
4 TRCN0000428441 CCCTTGGAGCACAAGATCATC pLKO_005 168 CDS 100% 4.950 2.475 Y POLR2J2 n/a
5 TRCN0000152711 CTTGGAGCACAAGATCATCAT pLKO.1 170 CDS 100% 4.950 2.475 Y POLR2J3 n/a
6 TRCN0000021870 GCAAGTGCTATTTGCTGGCTA pLKO.1 134 CDS 100% 2.640 1.320 Y POLR2J n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001371100.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01243 pDONR223 100% 74.3% 74.3% None 53_54ins90 n/a
2 ccsbBroad304_01243 pLX_304 0% 74.3% 74.3% V5 53_54ins90 n/a
3 TRCN0000474650 ACAATCGTGAGTCTTCATTCAACT pLX_317 94.6% 74.3% 74.3% V5 53_54ins90 n/a
Download CSV