Transcript: Human NM_001371333.1

Homo sapiens diablo IAP-binding mitochondrial protein (DIABLO), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-07-18
Taxon:
Homo sapiens (human)
Gene:
DIABLO (56616)
Length:
1471
CDS:
39..758

Additional Resources:

NCBI RefSeq record:
NM_001371333.1
NBCI Gene record:
DIABLO (56616)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001371333.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000350340 CGCAGATCAGGCCTCTATAAC pLKO_005 563 CDS 100% 13.200 18.480 N DIABLO n/a
2 TRCN0000004512 GCGTTGATTGAAGCTATTACT pLKO.1 321 CDS 100% 5.625 7.875 N DIABLO n/a
3 TRCN0000004514 CCGTTTCTCTATTGTATCCAA pLKO.1 1394 3UTR 100% 3.000 4.200 N DIABLO n/a
4 TRCN0000320623 TGCGTTGATTGAAGCTATTAC pLKO_005 320 CDS 100% 13.200 9.240 N DIABLO n/a
5 TRCN0000350339 TTGGGCACTGCACCCTGTTTA pLKO_005 956 3UTR 100% 13.200 9.240 N DIABLO n/a
6 TRCN0000004513 CCGACAATATACAAGTTTACT pLKO.1 380 CDS 100% 5.625 3.938 N DIABLO n/a
7 TRCN0000320554 CCGACAATATACAAGTTTACT pLKO_005 380 CDS 100% 5.625 3.938 N DIABLO n/a
8 TRCN0000004511 GCACAGAAATCAGAGCCTCAT pLKO.1 216 CDS 100% 4.050 2.835 N DIABLO n/a
9 TRCN0000320541 GCACAGAAATCAGAGCCTCAT pLKO_005 216 CDS 100% 4.050 2.835 N DIABLO n/a
10 TRCN0000004515 GTGACGATTGGCTTTGGAGTA pLKO.1 174 CDS 100% 4.050 2.835 N DIABLO n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001371333.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03728 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03728 pLX_304 75.3% 100% 100% V5 n/a
3 TRCN0000474122 TGTAAAGCACTTATAACTACAAGC pLX_317 66% 100% 100% V5 n/a
Download CSV