Transcript: Human NM_001371340.1

Homo sapiens LIM zinc finger domain containing 4 (LIMS4), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-11
Taxon:
Homo sapiens (human)
Gene:
LIMS4 (100288695)
Length:
2350
CDS:
298..1494

Additional Resources:

NCBI RefSeq record:
NM_001371340.1
NBCI Gene record:
LIMS4 (100288695)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001371340.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149648 GAGACGATCGTGAACAGTAAT pLKO.1 544 CDS 100% 13.200 6.600 Y LIMS3 n/a
2 TRCN0000059042 CGAGTTATCAAAGCCATGAAT pLKO.1 724 CDS 100% 5.625 2.813 Y LIMS1 n/a
3 TRCN0000148822 CAGTGACGTGAAAGTCTACAA pLKO.1 432 CDS 100% 4.950 2.475 Y LIMS3 n/a
4 TRCN0000059041 CCCTGTCATAATCGTGAGAAA pLKO.1 841 CDS 100% 4.950 2.475 Y LIMS1 n/a
5 TRCN0000148598 CTACAAGGAGTTCTGTGACTT pLKO.1 447 CDS 100% 4.950 2.475 Y LIMS3 n/a
6 TRCN0000149869 CGTGAAAGTCTACAAGGAGTT pLKO.1 438 CDS 100% 4.050 2.025 Y LIMS3 n/a
7 TRCN0000370331 CACTAAATTAACACTCAAGAA pLKO_005 1329 CDS 100% 4.950 2.475 Y LIMS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001371340.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06524 pDONR223 100% 76.9% 76.3% None (many diffs) n/a
2 ccsbBroad304_06524 pLX_304 0% 76.9% 76.3% V5 (many diffs) n/a
3 TRCN0000468941 TAGATCCTATTATCCCACTCTTGT pLX_317 39.8% 76.9% 76.3% V5 (many diffs) n/a
4 ccsbBroadEn_04624 pDONR223 100% 29.2% 28.6% None (many diffs) n/a
5 ccsbBroad304_04624 pLX_304 0% 29.2% 28.6% V5 (many diffs) n/a
6 TRCN0000469496 CCTGCACGGGACAGCCCGTCTAAT pLX_317 100% 29.2% 28.6% V5 (many diffs) n/a
Download CSV