Construct: ORF TRCN0000468941
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015851.1_s317c1
- Derived from:
- ccsbBroadEn_06524
- DNA Barcode:
- TAGATCCTATTATCCCACTCTTGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LIMS1 (3987)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468941
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3987 | LIMS1 | LIM zinc finger domain cont... | NM_001193488.2 | 99.7% | 99.3% | 233T>C;785A>G |
| 2 | human | 3987 | LIMS1 | LIM zinc finger domain cont... | NM_001371498.1 | 99.7% | 99.3% | 233T>C;785A>G |
| 3 | human | 3987 | LIMS1 | LIM zinc finger domain cont... | NM_004987.6 | 99.7% | 99.3% | 233T>C;785A>G |
| 4 | human | 3987 | LIMS1 | LIM zinc finger domain cont... | NM_001193482.2 | 98.5% | 98.1% | 1_12del;245T>C;797A>G |
| 5 | human | 3987 | LIMS1 | LIM zinc finger domain cont... | NM_001371497.1 | 97.6% | 97.2% | 1_21del;254T>C;806A>G |
| 6 | human | 3987 | LIMS1 | LIM zinc finger domain cont... | NM_001193483.3 | 96.2% | 95.8% | 1_36del;269T>C;821A>G |
| 7 | human | 3987 | LIMS1 | LIM zinc finger domain cont... | NM_001371496.1 | 93.7% | 93.3% | 1_63del;296T>C;848A>G |
| 8 | human | 3987 | LIMS1 | LIM zinc finger domain cont... | NM_001193484.2 | 89.5% | 89.2% | 1_111del;344T>C;896A>G |
| 9 | human | 3987 | LIMS1 | LIM zinc finger domain cont... | NM_001371495.1 | 88.5% | 88.2% | (many diffs) |
| 10 | human | 3987 | LIMS1 | LIM zinc finger domain cont... | NM_001193485.3 | 83.8% | 83.4% | 1_186del;419T>C;971A>G |
| 11 | human | 3987 | LIMS1 | LIM zinc finger domain cont... | NM_001371494.1 | 77.5% | 77.1% | (many diffs) |
| 12 | human | 100288695 | LIMS4 | LIM zinc finger domain cont... | NM_001371340.1 | 76.9% | 76.3% | (many diffs) |
| 13 | human | 100288695 | LIMS4 | LIM zinc finger domain cont... | XM_017003104.2 | 76% | 70% | (many diffs) |
| 14 | human | 100288695 | LIMS4 | LIM zinc finger domain cont... | XM_017003105.2 | 75.9% | 73.1% | (many diffs) |
| 15 | human | 100288695 | LIMS4 | LIM zinc finger domain cont... | XM_017003103.2 | 75.9% | 70.7% | (many diffs) |
| 16 | human | 55679 | LIMS2 | LIM zinc finger domain cont... | NM_001256542.1 | 42.7% | 46.4% | (many diffs) |
| 17 | human | 55679 | LIMS2 | LIM zinc finger domain cont... | XM_024452985.1 | 42.7% | 46.4% | (many diffs) |
| 18 | human | 55679 | LIMS2 | LIM zinc finger domain cont... | XM_024452986.1 | 42.7% | 46.4% | (many diffs) |
| 19 | human | 96626 | LIMS3 | LIM zinc finger domain cont... | NR_027467.3 | 39.9% | (many diffs) | |
| 20 | human | 100288695 | LIMS4 | LIM zinc finger domain cont... | NR_038099.1 | 35.9% | (many diffs) | |
| 21 | human | 100271835 | LIMS3-LOC440895 | LIMS3-LOC440895 readthrough | NR_027145.2 | 29.2% | (many diffs) | |
| 22 | human | 3987 | LIMS1 | LIM zinc finger domain cont... | NM_001371500.1 | 15% | 14.3% | (many diffs) |
| 23 | human | 3987 | LIMS1 | LIM zinc finger domain cont... | NM_001371499.1 | 14% | 13.4% | (many diffs) |
| 24 | human | 100288695 | LIMS4 | LIM zinc finger domain cont... | NM_001205288.2 | 13.9% | 13.1% | (many diffs) |
| 25 | human | 96626 | LIMS3 | LIM zinc finger domain cont... | NM_033514.5 | 13.9% | 13.1% | (many diffs) |
| 26 | mouse | 110829 | Lims1 | LIM and senescent cell anti... | XM_006513073.2 | 90.4% | 98.7% | (many diffs) |
| 27 | mouse | 110829 | Lims1 | LIM and senescent cell anti... | NM_026148.3 | 87.2% | 95.2% | (many diffs) |
| 28 | mouse | 110829 | Lims1 | LIM and senescent cell anti... | XM_006513072.2 | 84.2% | 91% | (many diffs) |
| 29 | mouse | 110829 | Lims1 | LIM and senescent cell anti... | XM_006513071.2 | 81.3% | 87.9% | (many diffs) |
| 30 | mouse | 110829 | Lims1 | LIM and senescent cell anti... | NM_201242.1 | 81.2% | 88.6% | (many diffs) |
| 31 | mouse | 110829 | Lims1 | LIM and senescent cell anti... | NM_001346676.1 | 75.9% | 82.9% | (many diffs) |
| 32 | mouse | 110829 | Lims1 | LIM and senescent cell anti... | XM_006513070.3 | 75.9% | 82% | (many diffs) |
| 33 | mouse | 110829 | Lims1 | LIM and senescent cell anti... | NM_001193303.1 | 71.5% | 77.2% | (many diffs) |
| 34 | mouse | 110829 | Lims1 | LIM and senescent cell anti... | XM_006513068.3 | 71.1% | 76.8% | (many diffs) |
| 35 | mouse | 110829 | Lims1 | LIM and senescent cell anti... | XM_006513074.3 | 13% | 13.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1041
- ORF length:
- 975
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc caacgccctg gccagcgcca cttgcgagcg ctgcaagggc ggctttgcgc 121 ccgctgagaa gatcgtgaac agtaatgggg agctgtacca tgagcagtgt ttcgtgtgcg 181 ctcagtgctt ccagcagttc ccagaaggac tcttctatga gtttgaagga agaaagtact 241 gtgaacatga ctttcagatg ctctttgccc cttgctgtca tcagtgtggt gaattcacca 301 ttggccgagt tatcaaagcc atgaataaca gctggcatcc ggagtgcttc cgctgtgacc 361 tctgccagga agttctggca gatatcgggt ttgtcaagaa tgctgggaga cacctgtgtc 421 gcccctgtca taatcgtgag aaagccagag gccttgggaa atacatctgc cagaaatgcc 481 atgctatcat cgatgagcag cctctgatat tcaagaacga cccctaccat ccagaccatt 541 tcaactgcgc caactgcggg aaggagctga ctgccgatgc acgggagctg aaaggggagc 601 tatactgcct cccatgccat gataaaatgg gggtccccat ctgtggtgct tgccGACGGC 661 CCATCGAAGG GCGCGTGGTG AACGCTATGG GCAAGCAGTG GCATGTGGAG CATTTTGTTT 721 GTGCCAAGTG TGAGAAACCC TTTCTTGGAC ATCGCCATTA TGAGAGGAAA GGCCTGGCAT 781 ATTGTGAAAC TCACTATAAC CAGCTATTTG GTGATGTTTG CTTCCACTGC AATCGTGTTA 841 TAGAAGGTGG TGTGGTCTCT GCTCTTAATA AGGCCTGGTG CGTGAACTGC TTTGCCTGTT 901 CTACCTGCAA CACTAAATTA ACACTCAAGA ATAAGTTTGT GGAGTTTGAC ATGAAGCCAG 961 TCTGTAAGAA GTGCTATGAG AAATTTCCAT TGGAGCTGAA GAAAAGACTT AAGAAACTAG 1021 CTGAGACCTT AGGAAGGAAA TACCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1081 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1141 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGATAGA TCCTATTATC 1201 CCACTCTTGT ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt