Transcript: Human NM_001371771.1

Homo sapiens adenylate kinase 8 (AK8), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-07-25
Taxon:
Homo sapiens (human)
Gene:
AK8 (158067)
Length:
1559
CDS:
97..1449

Additional Resources:

NCBI RefSeq record:
NM_001371771.1
NBCI Gene record:
AK8 (158067)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001371771.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358967 CAAAGCAACCATCGTACTAAT pLKO_005 781 CDS 100% 13.200 18.480 N AK8 n/a
2 TRCN0000358966 CATCGAGAGTGGGATCATTAA pLKO_005 1404 CDS 100% 13.200 18.480 N AK8 n/a
3 TRCN0000078679 CCAGCACTTGCATAGAGACAA pLKO.1 150 CDS 100% 4.950 6.930 N AK8 n/a
4 TRCN0000078680 CCCTCAAACTGGAGAGATTTA pLKO.1 552 CDS 100% 13.200 9.240 N AK8 n/a
5 TRCN0000359047 TCACACCCAGACACGTCATTG pLKO_005 476 CDS 100% 10.800 7.560 N AK8 n/a
6 TRCN0000078682 CTGACTCTGAGAAGAATTGAT pLKO.1 1174 CDS 100% 5.625 3.938 N AK8 n/a
7 TRCN0000078678 GCTGACTTGGAGCAGTTGTAT pLKO.1 1330 CDS 100% 5.625 3.938 N AK8 n/a
8 TRCN0000078681 GCACTTGCATAGAGACAACGA pLKO.1 153 CDS 100% 2.640 1.848 N AK8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001371771.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05092 pDONR223 100% 93.9% 93.9% None 0_1ins87 n/a
2 ccsbBroad304_05092 pLX_304 0% 93.9% 93.9% V5 0_1ins87 n/a
3 ccsbBroadEn_15271 pDONR223 0% 93.9% 93.9% None 0_1ins87 n/a
4 ccsbBroad304_15271 pLX_304 0% 93.9% 93.9% V5 0_1ins87 n/a
5 TRCN0000480307 CCATCGTTTCGTGATACCTGTAGT pLX_317 30.2% 93.9% 93.9% V5 (not translated due to frame shift) 0_1ins87 n/a
Download CSV