Transcript: Mouse NM_001372408.1

Mus musculus mitochondrial fission factor (Mff), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-08-30
Taxon:
Mus musculus (mouse)
Gene:
Mff (75734)
Length:
1869
CDS:
317..1195

Additional Resources:

NCBI RefSeq record:
NM_001372408.1
NBCI Gene record:
Mff (75734)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001372408.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000168097 CGTCAGGTATGGCATTTCAAA pLKO.1 973 CDS 100% 5.625 7.875 N MFF n/a
2 TRCN0000194096 GAGAGCGTTCTATGAGTGAAA pLKO.1 696 CDS 100% 4.950 6.930 N Mff n/a
3 TRCN0000176439 CGAAGGTATTAGTCAGCGAAT pLKO.1 358 CDS 100% 4.050 5.670 N Mff n/a
4 TRCN0000329088 CGAAGGTATTAGTCAGCGAAT pLKO_005 358 CDS 100% 4.050 5.670 N Mff n/a
5 TRCN0000174875 GTATTCAATCACTGTAGCGTT pLKO.1 1138 CDS 100% 2.640 3.696 N Mff n/a
6 TRCN0000174539 CTTCATTAAGACGTCAGATAA pLKO.1 1047 CDS 100% 13.200 10.560 N Mff n/a
7 TRCN0000329090 CTTCATTAAGACGTCAGATAA pLKO_005 1047 CDS 100% 13.200 10.560 N Mff n/a
8 TRCN0000329032 ACAACGTCAGGTATGGCATTT pLKO_005 969 CDS 100% 10.800 8.640 N Mff n/a
9 TRCN0000329031 GTTGTGCAGTGGCACCTATAC pLKO_005 1379 3UTR 100% 10.800 8.640 N Mff n/a
10 TRCN0000174665 GATCGTGGTTACAGGAAATAA pLKO.1 484 CDS 100% 15.000 10.500 N Mff n/a
11 TRCN0000329089 GATCGTGGTTACAGGAAATAA pLKO_005 484 CDS 100% 15.000 10.500 N Mff n/a
12 TRCN0000168683 GCCACTTCTAATCCTCATCAT pLKO.1 947 CDS 100% 4.950 3.465 N MFF n/a
13 TRCN0000173319 GCTACCTGAAGATGGAGCTAA pLKO.1 805 CDS 100% 4.950 3.465 N Mff n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001372408.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12318 pDONR223 100% 74.4% 76.7% None (many diffs) n/a
2 ccsbBroad304_12318 pLX_304 0% 74.4% 76.7% V5 (many diffs) n/a
3 TRCN0000476502 ACCCCCATCCAACTTCCGGATCTA pLX_317 50.8% 74.4% 76.7% V5 (many diffs) n/a
Download CSV