Transcript: Human NM_001374400.1

Homo sapiens recombination signal binding protein for immunoglobulin kappa J region (RBPJ), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
RBPJ (3516)
Length:
5709
CDS:
83..1585

Additional Resources:

NCBI RefSeq record:
NM_001374400.1
NBCI Gene record:
RBPJ (3516)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001374400.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097284 GCAGACTCATTGGGCTACATT pLKO.1 3188 3UTR 100% 5.625 7.875 N Rbpj n/a
2 TRCN0000353944 GCAGACTCATTGGGCTACATT pLKO_005 3188 3UTR 100% 5.625 7.875 N Rbpj n/a
3 TRCN0000016204 CCCTAACGAATCAAACACAAA pLKO.1 1489 CDS 100% 4.950 6.930 N RBPJ n/a
4 TRCN0000305837 TAGGGAAGCTATGCGAAATTA pLKO_005 178 CDS 100% 15.000 12.000 N Rbpj n/a
5 TRCN0000421507 GCATGTAGAAGGAGGTAATTT pLKO_005 691 CDS 100% 15.000 10.500 N RBPJ n/a
6 TRCN0000414657 ATGGACCAAGGAACTTGTATA pLKO_005 1955 3UTR 100% 13.200 9.240 N RBPJ n/a
7 TRCN0000016205 GCACAGATAAGGCAGAGTATA pLKO.1 1077 CDS 100% 13.200 9.240 N RBPJ n/a
8 TRCN0000016207 CCAGACAGTTAGTACCAGATA pLKO.1 667 CDS 100% 4.950 3.465 N RBPJ n/a
9 TRCN0000016206 GCAGCTAAACTTGGAAGGAAA pLKO.1 421 CDS 100% 4.950 3.465 N RBPJ n/a
10 TRCN0000016203 GCTGGAATACAAGTTGAACAA pLKO.1 1904 3UTR 100% 4.950 3.465 N RBPJ n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001374400.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06435 pDONR223 100% 96.8% 95.6% None (many diffs) n/a
2 ccsbBroad304_06435 pLX_304 38.7% 96.8% 95.6% V5 (many diffs) n/a
3 TRCN0000470066 CCAATAGATCCTTCAAGCAGAACC pLX_317 29.2% 96.8% 95.6% V5 (many diffs) n/a
Download CSV