Transcript: Human NM_001374461.1

Homo sapiens ubiquitin protein ligase E3A (UBE3A), transcript variant 29, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
UBE3A (7337)
Length:
7249
CDS:
2782..5340

Additional Resources:

NCBI RefSeq record:
NM_001374461.1
NBCI Gene record:
UBE3A (7337)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001374461.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419838 GTCCCTGTATCTAACTCAAAT pLKO_005 5809 3UTR 100% 13.200 18.480 N UBE3A n/a
2 TRCN0000420837 ACGCTACTACCACCAGTTAAC pLKO_005 2814 CDS 100% 10.800 15.120 N UBE3A n/a
3 TRCN0000003369 CGGAATACTCAAGCAAAGAAA pLKO.1 5261 CDS 100% 5.625 7.875 N UBE3A n/a
4 TRCN0000433236 TTAGACGTGACCATATCATAG pLKO_005 4292 CDS 100% 10.800 8.640 N UBE3A n/a
5 TRCN0000427767 AGTACTGGGTCTGGCTATTTA pLKO_005 4563 CDS 100% 15.000 10.500 N UBE3A n/a
6 TRCN0000433600 GTAGAGAAAGAGAGGATTATT pLKO_005 3131 CDS 100% 15.000 10.500 N UBE3A n/a
7 TRCN0000003371 GAGACATTTCAGCAACTTATT pLKO.1 3733 CDS 100% 13.200 9.240 N UBE3A n/a
8 TRCN0000003368 CCTACATCTCATACTTGCTTT pLKO.1 5224 CDS 100% 4.950 3.465 N UBE3A n/a
9 TRCN0000003370 CCACCATTTGTAGACCACGTA pLKO.1 5763 3UTR 100% 2.640 1.848 N UBE3A n/a
10 TRCN0000003372 CCTGATGATGTGTCTGTGGAT pLKO.1 3397 CDS 100% 2.640 1.848 N UBE3A n/a
11 TRCN0000012894 CCCAATGATGTATGATCTAAA pLKO.1 4782 CDS 100% 13.200 7.920 N Ube3a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001374461.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11211 pDONR223 100% 68.6% 68.6% None 1_801del n/a
2 ccsbBroad304_11211 pLX_304 0% 68.6% 68.6% V5 1_801del n/a
3 TRCN0000477716 TACAGATGGAACTAACACCTAAGA pLX_317 22.9% 68.6% 68.6% V5 1_801del n/a
Download CSV