Transcript: Human NM_001443.3

Homo sapiens fatty acid binding protein 1 (FABP1), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
FABP1 (2168)
Length:
501
CDS:
46..429

Additional Resources:

NCBI RefSeq record:
NM_001443.3
NBCI Gene record:
FABP1 (2168)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001443.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059644 GTGTCGGAAATCGTGCAGAAT pLKO.1 157 CDS 100% 4.950 6.930 N FABP1 n/a
2 TRCN0000429143 TTCATGAAGGCAATCGGTCTG pLKO_005 97 CDS 100% 2.250 3.150 N FABP1 n/a
3 TRCN0000059645 CAAGTCTGTGACCGAACTCAA pLKO.1 339 CDS 100% 4.950 3.465 N FABP1 n/a
4 TRCN0000426110 CATTGGGTGACATTGTCTTCA pLKO_005 386 CDS 100% 4.950 3.465 N FABP1 n/a
5 TRCN0000059646 CTGGGTCCAAAGTGATCCAAA pLKO.1 206 CDS 100% 4.950 3.465 N FABP1 n/a
6 TRCN0000059643 GTGACAATAAACTGGTGACAA pLKO.1 305 CDS 100% 4.950 3.465 N FABP1 n/a
7 TRCN0000423473 AGCACTTCAAGTTCACCATCA pLKO_005 182 CDS 100% 4.050 2.835 N FABP1 n/a
8 TRCN0000059647 GAGAAAGTCAAGACAGTGGTT pLKO.1 274 CDS 100% 2.640 1.320 Y FABP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001443.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00534 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00534 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473657 TTACTCTATCCGTTGGAAATCTAG pLX_317 100% 100% 100% V5 n/a
Download CSV