Transcript: Human NM_001463.4

Homo sapiens frizzled related protein (FRZB), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
FRZB (2487)
Length:
2637
CDS:
86..1063

Additional Resources:

NCBI RefSeq record:
NM_001463.4
NBCI Gene record:
FRZB (2487)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001463.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000372278 ACGCAACTAAATCCCGAAATA pLKO_005 1054 CDS 100% 13.200 18.480 N FRZB n/a
2 TRCN0000014462 CGTCATCTTGGACTCAGTAAA pLKO.1 965 CDS 100% 13.200 18.480 N FRZB n/a
3 TRCN0000014458 CCGATCTAATTACAGCCTTAT pLKO.1 1484 3UTR 100% 10.800 15.120 N FRZB n/a
4 TRCN0000014459 CGCTGTAAATGTAAGCCTATT pLKO.1 614 CDS 100% 10.800 15.120 N FRZB n/a
5 TRCN0000372279 GCACTATTGCACATCATATTC pLKO_005 1141 3UTR 100% 13.200 9.240 N FRZB n/a
6 TRCN0000014460 GCCCTGGAACATGACTAAGAT pLKO.1 223 CDS 100% 5.625 3.938 N FRZB n/a
7 TRCN0000014461 CCACTTAATGTTAATGAGGAA pLKO.1 824 CDS 100% 2.640 1.848 N FRZB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001463.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06223 pDONR223 100% 99.8% 99.6% None 975C>A n/a
2 ccsbBroad304_06223 pLX_304 0% 99.8% 99.6% V5 975C>A n/a
3 TRCN0000472645 CTCGCCCATTAAGATGCGGACGTA pLX_317 44.3% 99.8% 99.6% V5 975C>A n/a
Download CSV