Transcript: Human NM_001607.4

Homo sapiens acetyl-CoA acyltransferase 1 (ACAA1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
ACAA1 (30)
Length:
1699
CDS:
93..1367

Additional Resources:

NCBI RefSeq record:
NM_001607.4
NBCI Gene record:
ACAA1 (30)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001607.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036071 CGTCTTTGAATACCCTGGGAA pLKO.1 1343 CDS 100% 2.640 3.696 N ACAA1 n/a
2 TRCN0000248122 GCATCAGAAATGGGTCTTATG pLKO_005 499 CDS 100% 10.800 8.640 N Acaa1b n/a
3 TRCN0000036070 GTGGACATCTTCGAGATCAAT pLKO.1 1107 CDS 100% 5.625 4.500 N ACAA1 n/a
4 TRCN0000217733 GGCATCAGAAATGGGTCTTAT pLKO.1 498 CDS 100% 13.200 9.240 N Acaa1a n/a
5 TRCN0000246455 GGCATCAGAAATGGGTCTTAT pLKO_005 498 CDS 100% 13.200 9.240 N Acaa1a n/a
6 TRCN0000036073 GCCTTCAAGAAAGATGGTTCT pLKO.1 879 CDS 100% 4.050 2.835 N ACAA1 n/a
7 TRCN0000036072 GTTTGGCATTTCACGGGAGAA pLKO.1 665 CDS 100% 4.050 2.835 N ACAA1 n/a
8 TRCN0000036069 CCACTGTCAATAGACAGTGTT pLKO.1 442 CDS 100% 0.495 0.347 N ACAA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001607.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00004 pDONR223 100% 100% 100% None n/a
2 TRCN0000479705 CATTGCATGACGAAACGACATTCC pLX_317 24.5% 100% 100% V5 n/a
3 ccsbBroadEn_05756 pDONR223 100% 77.9% 77.8% None 445_543del;817_996del;1160T>C n/a
4 ccsbBroad304_05756 pLX_304 0% 77.9% 77.8% V5 445_543del;817_996del;1160T>C n/a
5 TRCN0000474186 TGTATAACCACATTTATCGGGCTC pLX_317 51.8% 77.9% 77.8% V5 445_543del;817_996del;1160T>C n/a
Download CSV