Transcript: Human NM_001676.6

Homo sapiens ATPase H+/K+ transporting non-gastric alpha2 subunit (ATP12A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
ATP12A (479)
Length:
4427
CDS:
337..3456

Additional Resources:

NCBI RefSeq record:
NM_001676.6
NBCI Gene record:
ATP12A (479)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001676.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422804 TAATGACTCTCCGGCTCTAAA pLKO_005 2538 CDS 100% 13.200 18.480 N ATP12A n/a
2 TRCN0000435044 ACTGTCACCGGCATGGTTATC pLKO_005 1138 CDS 100% 10.800 15.120 N ATP12A n/a
3 TRCN0000043155 CCTCAAGAAGACTATTGCTTA pLKO.1 2694 CDS 100% 4.950 6.930 N ATP12A n/a
4 TRCN0000043157 CTTGTGTATTTCACCGTCTAT pLKO.1 2980 CDS 100% 4.950 6.930 N ATP12A n/a
5 TRCN0000043154 GCCTCCTTATCCAAGATAATA pLKO.1 1636 CDS 100% 15.000 10.500 N ATP12A n/a
6 TRCN0000043156 CGCACCATCATTGGCCATATT pLKO.1 1171 CDS 100% 13.200 9.240 N ATP12A n/a
7 TRCN0000425159 TTGCCTTGGCGTACGAGAAAG pLKO_005 2840 CDS 100% 10.800 7.560 N ATP12A n/a
8 TRCN0000043153 GCCATTGAGATCGAGCACTTT pLKO.1 1234 CDS 100% 4.950 3.465 N ATP12A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001676.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05866 pDONR223 100% 99.3% 99.4% None 797_798insAGCATCTACTTCCCCTGT;1587C>T n/a
2 ccsbBroad304_05866 pLX_304 0% 99.3% 99.4% V5 (not translated due to frame shift) 797_798insAGCATCTACTTCCCCTGT;1587C>T n/a
3 TRCN0000467164 GACTCTCCTCGTACCATCCACGCC pLX_317 13.5% 99.3% 99.4% V5 (not translated due to prior stop codon) 797_798insAGCATCTACTTCCCCTGT;1587C>T n/a
Download CSV