Transcript: Human NM_001679.4

Homo sapiens ATPase Na+/K+ transporting subunit beta 3 (ATP1B3), mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
ATP1B3 (483)
Length:
1847
CDS:
160..999

Additional Resources:

NCBI RefSeq record:
NM_001679.4
NBCI Gene record:
ATP1B3 (483)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001679.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436676 GCATAGTATGAGTAGGATATC pLKO_005 994 CDS 100% 10.800 15.120 N ATP1B3 n/a
2 TRCN0000043371 CAGACTCTCAACGATGAGGTT pLKO.1 346 CDS 100% 2.640 2.112 N ATP1B3 n/a
3 TRCN0000043368 GCCAACATCAAGTGACTTTAT pLKO.1 1398 3UTR 100% 13.200 9.240 N ATP1B3 n/a
4 TRCN0000433698 TGAACAGAAGGGTCCAGTTTA pLKO_005 561 CDS 100% 13.200 9.240 N ATP1B3 n/a
5 TRCN0000425916 TGACATTGGGTTACATCATAA pLKO_005 1114 3UTR 100% 13.200 9.240 N ATP1B3 n/a
6 TRCN0000422619 TGATGGATCAGCCAACCTAAA pLKO_005 915 CDS 100% 10.800 7.560 N ATP1B3 n/a
7 TRCN0000043370 CATGTCAGTTTCCTATTTCAT pLKO.1 587 CDS 100% 5.625 3.938 N ATP1B3 n/a
8 TRCN0000043369 GCAGGGTACATTGAAGACCTT pLKO.1 469 CDS 100% 2.640 1.848 N ATP1B3 n/a
9 TRCN0000043372 CCTAACAACACTGGGAAAGAA pLKO.1 874 CDS 100% 5.625 3.375 N ATP1B3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001679.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00124 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00124 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472479 CGCTATTCGTAGTGCAGTTTGGGA pLX_317 14.4% 100% 100% V5 n/a
Download CSV