Transcript: Human NM_001775.4

Homo sapiens CD38 molecule (CD38), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
CD38 (952)
Length:
5620
CDS:
88..990

Additional Resources:

NCBI RefSeq record:
NM_001775.4
NBCI Gene record:
CD38 (952)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001775.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050868 GCATACCTTTATTGTGATCTA pLKO.1 1164 3UTR 100% 4.950 3.960 N CD38 n/a
2 TRCN0000050872 CCTCACATGGTGTGGTGAATT pLKO.1 555 CDS 100% 0.000 0.000 N CD38 n/a
3 TRCN0000050870 CCAAAGTGTATGGGATGCTTT pLKO.1 333 CDS 100% 4.950 3.465 N CD38 n/a
4 TRCN0000050869 CCAGAGAAGGTTCAGACACTA pLKO.1 781 CDS 100% 4.950 3.465 N CD38 n/a
5 TRCN0000050871 CTGAGGATTCATCTTGCACAT pLKO.1 959 CDS 100% 4.050 2.835 N CD38 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001775.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00258 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00258 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479471 CCCGACCGCCGTAAACGATGTCAC pLX_317 41.8% 100% 100% V5 n/a
Download CSV