Transcript: Human NM_001804.3

Homo sapiens caudal type homeobox 1 (CDX1), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
CDX1 (1044)
Length:
1775
CDS:
100..897

Additional Resources:

NCBI RefSeq record:
NM_001804.3
NBCI Gene record:
CDX1 (1044)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001804.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430831 ACAAGTACCGCGTGGTCTACA pLKO_005 563 CDS 100% 4.950 6.930 N CDX1 n/a
2 TRCN0000008624 CAGCGGTAAGACTCGGACCAA pLKO.1 540 CDS 100% 0.880 1.232 N CDX1 n/a
3 TRCN0000008621 CGCAAAGTGAACAAGAAGAAA pLKO.1 727 CDS 100% 5.625 4.500 N CDX1 n/a
4 TRCN0000008620 ACCACACTGATCCTGGAGAAA pLKO.1 1253 3UTR 100% 4.950 3.960 N CDX1 n/a
5 TRCN0000008622 GTTTCATTACAGCCGTTACAT pLKO.1 615 CDS 100% 5.625 3.938 N CDX1 n/a
6 TRCN0000008623 TCCTCTCCAATGCCTGTGAAA pLKO.1 859 CDS 100% 4.950 3.465 N CDX1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001804.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10730 pDONR223 100% 56.9% 55% None (many diffs) n/a
2 ccsbBroad304_10730 pLX_304 0% 56.9% 55% V5 (many diffs) n/a
3 TRCN0000465622 TGCCTTCGGTTAAAAAAGCTCTCC pLX_317 84.5% 56.9% 55% V5 (many diffs) n/a
Download CSV