Transcript: Human NM_001831.4

Homo sapiens clusterin (CLU), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
CLU (1191)
Length:
2749
CDS:
76..1425

Additional Resources:

NCBI RefSeq record:
NM_001831.4
NBCI Gene record:
CLU (1191)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001831.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078612 AGGGAAGTAAGTACGTCAATA pLKO.1 185 CDS 100% 13.200 18.480 N CLU n/a
2 TRCN0000078610 CAGGGAAGTAAGTACGTCAAT pLKO.1 184 CDS 100% 4.950 6.930 N CLU n/a
3 TRCN0000300844 CAGGGAAGTAAGTACGTCAAT pLKO_005 184 CDS 100% 4.950 6.930 N CLU n/a
4 TRCN0000304144 CCAGGAAGAACCCTAAATTTA pLKO_005 1346 CDS 100% 15.000 10.500 N CLU n/a
5 TRCN0000310829 AGCAGCTGAACGAGCAGTTTA pLKO_005 1154 CDS 100% 13.200 9.240 N CLU n/a
6 TRCN0000304143 TTGCTCCTGCATGCAACTAAT pLKO_005 1625 3UTR 100% 13.200 9.240 N CLU n/a
7 TRCN0000078608 CCGGTTTATATGATCTTCATA pLKO.1 2240 3UTR 100% 5.625 3.938 N CLU n/a
8 TRCN0000078609 CCTGAAACAGACCTGCATGAA pLKO.1 423 CDS 100% 4.950 3.465 N CLU n/a
9 TRCN0000078611 GCTAAAGTCCTACCAGTGGAA pLKO.1 1107 CDS 100% 2.640 1.848 N CLU n/a
10 TRCN0000300767 GCTAAAGTCCTACCAGTGGAA pLKO_005 1107 CDS 100% 2.640 1.848 N CLU n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001831.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00323 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00323 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000491595 AGCTTAGACTTGATGCCTCACACC pLX_317 25.4% 100% 100% V5 n/a
4 ccsbBroad304_00087 pLX_304 68.9% 56.9% 5.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV