Transcript: Human NM_001866.3

Homo sapiens cytochrome c oxidase subunit 7B (COX7B), mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
COX7B (1349)
Length:
2444
CDS:
87..329

Additional Resources:

NCBI RefSeq record:
NM_001866.3
NBCI Gene record:
COX7B (1349)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001866.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046326 CTGTATTGTTACATGGACATA pLKO.1 230 CDS 100% 4.950 6.930 N COX7B n/a
2 TRCN0000046327 CAAATACGGTAATGCTGTATT pLKO.1 191 CDS 100% 1.320 1.056 N COX7B n/a
3 TRCN0000046323 CCAGAAACGTACACCTGATTT pLKO.1 164 CDS 100% 13.200 9.240 N COX7B n/a
4 TRCN0000046324 GCAACACAAGTCGGAATAGAA pLKO.1 255 CDS 100% 5.625 3.938 N COX7B n/a
5 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 1845 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
6 TRCN0000138395 CCTTCCAAGTAGCTGGGATTA pLKO.1 840 3UTR 100% 10.800 5.400 Y C11orf88 n/a
7 TRCN0000046325 CGTCTCCAAGTTCGAAGCATT pLKO.1 117 CDS 100% 4.950 2.475 Y COX7B n/a
8 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 976 3UTR 100% 5.625 2.813 Y KLHL30 n/a
9 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 976 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001866.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06022 pDONR223 100% 99.5% 100% None 12G>A n/a
2 ccsbBroad304_06022 pLX_304 0% 99.5% 100% V5 12G>A n/a
3 TRCN0000481649 ATGATTGCGGCAATGCGTCGCGCA pLX_317 100% 99.5% 100% V5 12G>A n/a
Download CSV