Transcript: Human NM_001876.4

Homo sapiens carnitine palmitoyltransferase 1A (CPT1A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
CPT1A (1374)
Length:
5238
CDS:
156..2477

Additional Resources:

NCBI RefSeq record:
NM_001876.4
NBCI Gene record:
CPT1A (1374)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001876.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036283 GACAACGATGTACGCCAAGAT pLKO.1 365 CDS 100% 4.950 6.930 N CPT1A n/a
2 TRCN0000036282 CGATGTTACGACAGGTGGTTT pLKO.1 1494 CDS 100% 4.950 3.465 N CPT1A n/a
3 TRCN0000036281 CGTAGCCTTTGGTAAAGGAAT pLKO.1 1808 CDS 100% 4.950 3.465 N CPT1A n/a
4 TRCN0000036279 GCCATGAAGCTCTTAGACAAA pLKO.1 226 CDS 100% 4.950 3.465 N CPT1A n/a
5 TRCN0000110548 GCAACTATTATGCCATGGATT pLKO.1 910 CDS 100% 4.950 2.970 N Cpt1b n/a
6 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4247 3UTR 100% 5.625 2.813 Y KLHL30 n/a
7 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4247 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001876.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00359 pDONR223 100% 97.1% 95.3% None (many diffs) n/a
2 ccsbBroad304_00359 pLX_304 0% 97.1% 95.3% V5 (many diffs) n/a
3 TRCN0000466447 ATGTGTTTGCCGCACGCTGACCGC pLX_317 19% 97.1% 95.3% V5 (many diffs) n/a
Download CSV