Transcript: Human NM_001879.5

Homo sapiens mannan binding lectin serine peptidase 1 (MASP1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
MASP1 (5648)
Length:
6476
CDS:
391..2490

Additional Resources:

NCBI RefSeq record:
NM_001879.5
NBCI Gene record:
MASP1 (5648)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001879.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419636 TGGGTTTCGGATCAAGCTTTA pLKO_005 552 CDS 100% 10.800 15.120 N MASP1 n/a
2 TRCN0000046619 CCAGTGATTCAGAGGTGACTT pLKO.1 512 CDS 100% 4.950 3.465 N MASP1 n/a
3 TRCN0000046621 CCATCACTTTCCGGTCAGATT pLKO.1 734 CDS 100% 4.950 3.465 N MASP1 n/a
4 TRCN0000046618 GCCCTATTACAAGATGCTCAA pLKO.1 1587 CDS 100% 4.050 2.835 N MASP1 n/a
5 TRCN0000046620 GCTGAAGGATAATGTGGAGAT pLKO.1 1395 CDS 100% 4.050 2.835 N MASP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001879.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06786 pDONR223 100% 77.8% 72.1% None (many diffs) n/a
2 ccsbBroad304_06786 pLX_304 0% 77.8% 72.1% V5 (many diffs) n/a
3 TRCN0000474736 GAAGCAAGCTATATACGATGATGT pLX_317 17.3% 77.8% 72.1% V5 (many diffs) n/a
Download CSV