Transcript: Human NM_001891.3

Homo sapiens casein beta (CSN2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
CSN2 (1447)
Length:
1081
CDS:
17..697

Additional Resources:

NCBI RefSeq record:
NM_001891.3
NBCI Gene record:
CSN2 (1447)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001891.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230954 GAGTGATGCCTGTCCTTAAAT pLKO_005 354 CDS 100% 15.000 10.500 N CSN2 n/a
2 TRCN0000230953 CAAGCAGTGAGGAATCTATTA pLKO_005 84 CDS 100% 13.200 9.240 N CSN2 n/a
3 TRCN0000218763 ATGGAAGTCCCTAAAGCTAAA pLKO_005 311 CDS 100% 10.800 7.560 N CSN2 n/a
4 TRCN0000056122 GAAATAATGGAAGTCCCTAAA pLKO.1 305 CDS 100% 10.800 7.560 N CSN2 n/a
5 TRCN0000056119 TCAACCAAGAACTTCTACTTA pLKO.1 609 CDS 100% 5.625 3.938 N CSN2 n/a
6 TRCN0000056120 GTCCTTAAATCTCCAACGATA pLKO.1 365 CDS 100% 4.950 3.465 N CSN2 n/a
7 TRCN0000056121 GTGAGGAATCTATTACAGAAT pLKO.1 90 CDS 100% 4.950 3.465 N CSN2 n/a
8 TRCN0000056118 CCTCTGATCTATCCATTCGTT pLKO.1 203 CDS 100% 3.000 2.100 N CSN2 n/a
9 TRCN0000230955 CAACCAAGAACTTCTACTTAA pLKO_005 610 CDS 100% 13.200 7.920 N CSN2 n/a
10 TRCN0000230956 TTTGACTCATGAACTATTTAC pLKO_005 880 3UTR 100% 13.200 7.920 N CSN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001891.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00377 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00377 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473093 AGGCCGGGGACCTGGGGGATTATA pLX_317 62.9% 100% 100% V5 n/a
Download CSV