Transcript: Human NM_001916.5

Homo sapiens cytochrome c1 (CYC1), mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
CYC1 (1537)
Length:
1191
CDS:
25..1002

Additional Resources:

NCBI RefSeq record:
NM_001916.5
NBCI Gene record:
CYC1 (1537)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001916.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064606 CCAGGGAAGCTGTTCGACTAT pLKO.1 526 CDS 100% 4.950 6.930 N CYC1 n/a
2 TRCN0000064604 GCTGTTCGACTATTTCCCAAA pLKO.1 534 CDS 100% 4.050 5.670 N CYC1 n/a
3 TRCN0000064605 GCACAAGTGGTCAGTCCTGAA pLKO.1 948 CDS 100% 4.050 2.835 N CYC1 n/a
4 TRCN0000064603 CCCATCTACACAGATGTCTTA pLKO.1 763 CDS 100% 0.495 0.347 N CYC1 n/a
5 TRCN0000064607 GCTCTGCATTCGGCTGTGAGT pLKO.1 253 CDS 100% 0.880 0.528 N CYC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001916.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06070 pDONR223 100% 99.7% 99.6% None 99T>G;226A>G n/a
2 ccsbBroad304_06070 pLX_304 0% 99.7% 99.6% V5 99T>G;226A>G n/a
3 TRCN0000469903 CTACTGGGGTTACGGTAGGATCGT pLX_317 35.4% 99.7% 99.6% V5 99T>G;226A>G n/a
Download CSV