Transcript: Human NM_001934.3

Homo sapiens distal-less homeobox 4 (DLX4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
DLX4 (1748)
Length:
1765
CDS:
241..747

Additional Resources:

NCBI RefSeq record:
NM_001934.3
NBCI Gene record:
DLX4 (1748)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001934.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430494 TCGCCTCAGATGATGTGAATC pLKO_005 730 CDS 100% 10.800 15.120 N DLX4 n/a
2 TRCN0000434469 AGCAAGAAACATTGAGTATTT pLKO_005 1157 3UTR 100% 13.200 9.240 N DLX4 n/a
3 TRCN0000013773 CCCTAACCCTAACAGCTAAAT pLKO.1 909 3UTR 100% 13.200 9.240 N DLX4 n/a
4 TRCN0000420626 TTGGCCTTGCACAACCCATTT pLKO_005 1196 3UTR 100% 10.800 7.560 N DLX4 n/a
5 TRCN0000013774 CAAGTATAAGAAGCTCCTGAA pLKO.1 534 CDS 100% 4.050 2.835 N DLX4 n/a
6 TRCN0000013775 GCAGCACCTAAACCAGCGTTT pLKO.1 411 CDS 100% 4.050 2.835 N DLX4 n/a
7 TRCN0000013776 CAACAGCTTTGGAGCCTGGTA pLKO.1 681 CDS 100% 2.640 1.848 N DLX4 n/a
8 TRCN0000013777 GCTCCGCAAGCCGAGGACCAT pLKO.1 372 CDS 100% 0.000 0.000 N DLX4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001934.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00449 pDONR223 100% 68% 63.3% None (many diffs) n/a
2 ccsbBroad304_00449 pLX_304 0% 68% 63.3% V5 (many diffs) n/a
3 TRCN0000470561 TGTTTGGTCTGATGTGTGTGATAA pLX_317 20.6% 68% 63.3% V5 (many diffs) n/a
Download CSV