Transcript: Human NM_001976.5

Homo sapiens enolase 3 (ENO3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
ENO3 (2027)
Length:
1495
CDS:
109..1413

Additional Resources:

NCBI RefSeq record:
NM_001976.5
NBCI Gene record:
ENO3 (2027)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001976.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431052 ATCTTTGCTGGACGCAAGTTC pLKO_005 1372 CDS 100% 4.950 6.930 N ENO3 n/a
2 TRCN0000437329 GAATCGATCCAGGCGTGCAAA pLKO_005 1162 CDS 100% 4.950 6.930 N ENO3 n/a
3 TRCN0000118687 GCATCTGAGTTCTATCGCAAT pLKO.1 850 CDS 100% 4.050 5.670 N ENO3 n/a
4 TRCN0000118689 AGAGCTGTATAAGAGCTTTAT pLKO.1 939 CDS 100% 13.200 9.240 N ENO3 n/a
5 TRCN0000429798 CTATGAGGCTCTGGAACTAAG pLKO_005 237 CDS 100% 10.800 7.560 N ENO3 n/a
6 TRCN0000118690 ACCGAGAATAAGTCCAAGTTT pLKO.1 406 CDS 100% 5.625 3.938 N ENO3 n/a
7 TRCN0000118688 GCTGTATAAGAGCTTTATCAA pLKO.1 942 CDS 100% 5.625 3.938 N ENO3 n/a
8 TRCN0000419239 GTTGACAAATTTATGATTGAG pLKO_005 376 CDS 100% 4.950 3.465 N ENO3 n/a
9 TRCN0000118691 CTTGACTTCAAGTCGCCTGAT pLKO.1 883 CDS 100% 4.050 2.835 N ENO3 n/a
10 TRCN0000440359 TCAAGGAAGCCATGCGCATTG pLKO_005 641 CDS 100% 6.000 3.600 N ENO3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001976.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06162 pDONR223 100% 99.8% 99.5% None 212A>G;254T>C n/a
2 ccsbBroad304_06162 pLX_304 0% 99.8% 99.5% V5 212A>G;254T>C n/a
3 TRCN0000471202 GCTCCTATGGGACACACGCGCAGT pLX_317 39.4% 99.8% 99.5% V5 212A>G;254T>C n/a
Download CSV