Transcript: Human NM_002001.3

Homo sapiens Fc fragment of IgE receptor Ia (FCER1A), mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
FCER1A (2205)
Length:
1198
CDS:
107..880

Additional Resources:

NCBI RefSeq record:
NM_002001.3
NBCI Gene record:
FCER1A (2205)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002001.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029599 CCCTCAACATTACTGTAATAA pLKO.1 672 CDS 100% 15.000 12.000 N FCER1A n/a
2 TRCN0000029601 GCAGGTCACATTTCTCTTGAA pLKO.1 790 CDS 100% 4.950 3.960 N FCER1A n/a
3 TRCN0000029600 CCCTCCATGGAATAGAATATT pLKO.1 211 CDS 100% 15.000 10.500 N FCER1A n/a
4 TRCN0000426663 GTGTACAAGGTGATCTATTAT pLKO_005 524 CDS 100% 15.000 10.500 N FCER1A n/a
5 TRCN0000421643 ACATGTAATGGGAACAATTTC pLKO_005 254 CDS 100% 13.200 9.240 N FCER1A n/a
6 TRCN0000029602 CCACAACATCTCCATTACAAA pLKO.1 580 CDS 100% 5.625 3.938 N FCER1A n/a
7 TRCN0000029603 CAACAAGTTAATGAGAGTGAA pLKO.1 392 CDS 100% 4.950 3.465 N FCER1A n/a
8 TRCN0000434200 ACTGGTTAAGTGGCATGTAAT pLKO_005 1023 3UTR 100% 13.200 7.920 N FCER1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002001.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00544 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00544 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468480 AATACAGTTAAAGCCCATGCAATT pLX_317 49.6% 100% 100% V5 n/a
Download CSV