Transcript: Human NM_002035.4

Homo sapiens 3-ketodihydrosphingosine reductase (KDSR), mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
KDSR (2531)
Length:
5143
CDS:
89..1087

Additional Resources:

NCBI RefSeq record:
NM_002035.4
NBCI Gene record:
KDSR (2531)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002035.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251232 ATAACTCTGGTTGCACGAAAT pLKO_005 263 CDS 100% 10.800 15.120 N Kdsr n/a
2 TRCN0000064865 GCATTGCTATCGAGTGCTATA pLKO.1 228 CDS 100% 10.800 15.120 N KDSR n/a
3 TRCN0000286359 GCATTGCTATCGAGTGCTATA pLKO_005 228 CDS 100% 10.800 15.120 N KDSR n/a
4 TRCN0000064867 GCTGGTAAATTGTGCAGGAAT pLKO.1 439 CDS 100% 4.950 6.930 N KDSR n/a
5 TRCN0000298191 GCTGGTAAATTGTGCAGGAAT pLKO_005 439 CDS 100% 4.950 6.930 N KDSR n/a
6 TRCN0000293791 AGGATTCCAGAATGATCATTA pLKO_005 1373 3UTR 100% 13.200 9.240 N KDSR n/a
7 TRCN0000064863 CCAGTGGACATGCTGGTAAAT pLKO.1 428 CDS 100% 13.200 9.240 N KDSR n/a
8 TRCN0000286358 CCAGTGGACATGCTGGTAAAT pLKO_005 428 CDS 100% 13.200 9.240 N KDSR n/a
9 TRCN0000064864 GCCTTTGGAGACTCGACTTAT pLKO.1 781 CDS 100% 13.200 9.240 N KDSR n/a
10 TRCN0000286413 GCCTTTGGAGACTCGACTTAT pLKO_005 781 CDS 100% 13.200 9.240 N KDSR n/a
11 TRCN0000064866 GAAGCCATATAATGTCTACAT pLKO.1 700 CDS 100% 4.950 3.465 N KDSR n/a
12 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 4403 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002035.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06231 pDONR223 100% 99.8% 100% None 261G>A n/a
2 ccsbBroad304_06231 pLX_304 0% 99.8% 100% V5 261G>A n/a
3 TRCN0000468609 GAGCCATCAAATCGACTAGCCAAG pLX_317 37.4% 99.8% 100% V5 261G>A n/a
Download CSV