Transcript: Human NM_002043.5

Homo sapiens gamma-aminobutyric acid type A receptor rho2 subunit (GABRR2), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
GABRR2 (2570)
Length:
4738
CDS:
135..1532

Additional Resources:

NCBI RefSeq record:
NM_002043.5
NBCI Gene record:
GABRR2 (2570)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002043.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048673 GCCCAAGCCAAGTCACTTATA pLKO.1 236 CDS 100% 13.200 9.240 N GABRR2 n/a
2 TRCN0000415392 CATGTGTGGAATGCTTCATTC pLKO_005 1229 CDS 100% 10.800 7.560 N GABRR2 n/a
3 TRCN0000427189 GTGGACATGGACTTCACTATG pLKO_005 414 CDS 100% 10.800 7.560 N GABRR2 n/a
4 TRCN0000048675 CATTGACAAATACTCTAGGTT pLKO.1 1454 CDS 100% 3.000 2.100 N GABRR2 n/a
5 TRCN0000048674 CCTATACAGATGAAGATCTAA pLKO.1 733 CDS 100% 5.625 3.375 N GABRR2 n/a
6 TRCN0000048677 GTCTTCTTTGTTCACTCCAAA pLKO.1 546 CDS 100% 4.950 2.970 N GABRR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002043.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10835 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_10835 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472128 CTTCGTCCATTCGGTGCTGCAGGT pLX_317 11.9% 100% 100% V5 n/a
Download CSV