Transcript: Human NM_002068.4

Homo sapiens G protein subunit alpha 15 (GNA15), mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
GNA15 (2769)
Length:
2273
CDS:
419..1543

Additional Resources:

NCBI RefSeq record:
NM_002068.4
NBCI Gene record:
GNA15 (2769)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002068.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036464 CCCTATAAAGTGACCACGTTT pLKO.1 779 CDS 100% 4.950 6.930 N GNA15 n/a
2 TRCN0000036465 CCTCGCATTGTTTGGGACTAT pLKO.1 1180 CDS 100% 4.950 6.930 N GNA15 n/a
3 TRCN0000036467 CCTGCTCGATTCAGCCGTGTA pLKO.1 883 CDS 100% 1.350 1.890 N GNA15 n/a
4 TRCN0000036466 CCATTGTTTCGAGAACGTGAT pLKO.1 1078 CDS 100% 4.050 3.240 N GNA15 n/a
5 TRCN0000436535 GCACATCCGTCATCCTCTTTC pLKO_005 1224 CDS 100% 10.800 7.560 N GNA15 n/a
6 TRCN0000435273 ACAACCAGGAGAACCGCATGA pLKO_005 1152 CDS 100% 4.050 2.835 N GNA15 n/a
7 TRCN0000036468 CAAGAGGTTCATCCTGGACAT pLKO.1 1342 CDS 100% 4.050 2.835 N GNA15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002068.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06290 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_06290 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472295 AGGGCTGTAGACCAAGTACTTCTT pLX_317 45.7% 100% 100% V5 n/a
4 TRCN0000488855 GGCCCCACAATGGGCACACGACAA pLX_317 29.7% 100% 100% V5 (not translated due to prior stop codon) n/a
Download CSV