Transcript: Human NM_002150.3

Homo sapiens 4-hydroxyphenylpyruvate dioxygenase (HPD), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
HPD (3242)
Length:
1419
CDS:
37..1218

Additional Resources:

NCBI RefSeq record:
NM_002150.3
NBCI Gene record:
HPD (3242)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002150.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064924 CCCTCCACGTACTACAAACAA pLKO.1 910 CDS 100% 5.625 7.875 N HPD n/a
2 TRCN0000064925 CGGCCAATTCTTGCCTGGATA pLKO.1 495 CDS 100% 4.950 6.930 N HPD n/a
3 TRCN0000064926 CGGAATATAGCTCTCTGCGAT pLKO.1 692 CDS 100% 2.640 3.696 N HPD n/a
4 TRCN0000076349 CCAGGAATATGTGGACTATAA pLKO.1 792 CDS 100% 13.200 9.240 N Hpd n/a
5 TRCN0000076351 TCCAGGAATATGTGGACTATA pLKO.1 791 CDS 100% 13.200 9.240 N Hpd n/a
6 TRCN0000432311 GGGTAGAGCAAGACAAGTTTG pLKO_005 401 CDS 100% 10.800 7.560 N HPD n/a
7 TRCN0000064923 CGGCAACTTCAACTCACTGTT pLKO.1 1119 CDS 100% 4.950 3.465 N HPD n/a
8 TRCN0000064927 CTGGAGATGATCGACCACATT pLKO.1 568 CDS 100% 4.950 3.465 N HPD n/a
9 TRCN0000417378 AGAGAGGCCTGGAGTTCTTAT pLKO_005 884 CDS 100% 13.200 7.920 N HPD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002150.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00781 pDONR223 100% 99.9% 99.7% None 97A>G n/a
2 ccsbBroad304_00781 pLX_304 0% 99.9% 99.7% V5 97A>G n/a
3 TRCN0000472809 CTTCGACAGGAACCACACGTTATT pLX_317 33.5% 99.9% 99.7% V5 97A>G n/a
Download CSV