Transcript: Human NM_002160.4

Homo sapiens tenascin C (TNC), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
TNC (3371)
Length:
8500
CDS:
313..6918

Additional Resources:

NCBI RefSeq record:
NM_002160.4
NBCI Gene record:
TNC (3371)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002160.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230787 CAGGCGCAAACGGGCATAAAT pLKO_005 6900 CDS 100% 15.000 21.000 N TNC n/a
2 TRCN0000157798 CCACGGAATACACACTGAGAA pLKO.1 5891 CDS 100% 4.950 6.930 N TNC n/a
3 TRCN0000157797 CCAGTGGTGTTTAACCACGTT pLKO.1 451 CDS 100% 0.264 0.370 N TNC n/a
4 TRCN0000230786 ACCTAACCATTTCCGACATTA pLKO_005 4913 CDS 100% 13.200 10.560 N TNC n/a
5 TRCN0000218684 AGGCTACTGAATACGAAATTG pLKO_005 5357 CDS 100% 13.200 10.560 N TNC n/a
6 TRCN0000152185 CCTAACCATTTCCGACATTAA pLKO.1 4914 CDS 100% 13.200 10.560 N TNC n/a
7 TRCN0000230785 GGAGTACTTTATCCGTGTATT pLKO_005 2370 CDS 100% 13.200 10.560 N TNC n/a
8 TRCN0000230788 CCAGTGACAACATCGCAATAG pLKO_005 7168 3UTR 100% 10.800 7.560 N TNC n/a
9 TRCN0000154001 CCACTGGAAATAACCCTACTT pLKO.1 5299 CDS 100% 4.950 3.465 N TNC n/a
10 TRCN0000157688 CCAGGAATCTTCGACGTGTTT pLKO.1 2999 CDS 100% 4.950 3.465 N TNC n/a
11 TRCN0000157942 CCACGAACACTCAATCCAGTT pLKO.1 6834 CDS 100% 4.050 2.835 N TNC n/a
12 TRCN0000156613 GCATCAATACAACCAGCCCAA pLKO.1 6981 3UTR 100% 2.160 1.512 N TNC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002160.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13879 pDONR223 100% 87.4% 7.4% None (many diffs) n/a
2 ccsbBroad304_13879 pLX_304 0% 87.4% 7.4% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000479308 AGAAGCATTGCACCCCTCCGACGG pLX_317 6.8% 87.4% 7.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV