Transcript: Human NM_002207.3

Homo sapiens integrin subunit alpha 9 (ITGA9), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
ITGA9 (3680)
Length:
7860
CDS:
235..3342

Additional Resources:

NCBI RefSeq record:
NM_002207.3
NBCI Gene record:
ITGA9 (3680)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002207.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000057739 CCGAAGGTACAAAGAAATTAT pLKO.1 3258 CDS 100% 15.000 21.000 N ITGA9 n/a
2 TRCN0000057740 CGCTGGAAGAACATCTACTAT pLKO.1 667 CDS 100% 5.625 4.500 N ITGA9 n/a
3 TRCN0000057738 CCGAAGACATTTCACATCTTT pLKO.1 3929 3UTR 100% 5.625 3.938 N ITGA9 n/a
4 TRCN0000057741 GCTGTGTTTAAGTGCCGTGTT pLKO.1 481 CDS 100% 4.050 2.835 N ITGA9 n/a
5 TRCN0000057742 GCTGTGAAGAACATCTCCCTA pLKO.1 2185 CDS 100% 2.640 1.848 N ITGA9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002207.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10926 pDONR223 100% 60.2% 59.3% None (many diffs) n/a
2 ccsbBroad304_10926 pLX_304 0% 60.2% 59.3% V5 (many diffs) n/a
3 TRCN0000475453 AGAGTCCTTCGAAGATTGCCAAGC pLX_317 19.6% 60.2% 59.3% V5 (many diffs) n/a
Download CSV