Transcript: Human NM_002238.4

Homo sapiens potassium voltage-gated channel subfamily H member 1 (KCNH1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
KCNH1 (3756)
Length:
8059
CDS:
204..3092

Additional Resources:

NCBI RefSeq record:
NM_002238.4
NBCI Gene record:
KCNH1 (3756)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002238.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429076 AGGATTGAGTGAGCGAGTAAT pLKO_005 1712 CDS 100% 13.200 18.480 N KCNH1 n/a
2 TRCN0000019296 CGGCGGTCCAATGATACTAAT pLKO.1 270 CDS 100% 13.200 18.480 N KCNH1 n/a
3 TRCN0000019298 GCTGGACCACTACATTGAATA pLKO.1 1223 CDS 100% 13.200 18.480 N KCNH1 n/a
4 TRCN0000019295 CCTCACATCATCTTACATTAT pLKO.1 822 CDS 100% 13.200 10.560 N KCNH1 n/a
5 TRCN0000424977 AGCCATCTTGGTCCCTTATAA pLKO_005 896 CDS 100% 15.000 10.500 N KCNH1 n/a
6 TRCN0000431514 GGTGGACATTGTGCTCAATTT pLKO_005 989 CDS 100% 13.200 9.240 N KCNH1 n/a
7 TRCN0000019294 CGGCAAACATTTGAGAACTAT pLKO.1 453 CDS 100% 5.625 3.938 N KCNH1 n/a
8 TRCN0000019297 CGGAAGATCAGCGATGTGAAA pLKO.1 2244 CDS 100% 4.950 3.465 N KCNH1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002238.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000477687 CTACCTGCTTTGCGTCGACTGAAT pLX_317 13.8% 99.6% 99.5% V5 (many diffs) n/a
Download CSV