Transcript: Human NM_002239.4

Homo sapiens potassium inwardly rectifying channel subfamily J member 3 (KCNJ3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
KCNJ3 (3760)
Length:
4628
CDS:
82..1587

Additional Resources:

NCBI RefSeq record:
NM_002239.4
NBCI Gene record:
KCNJ3 (3760)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002239.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434702 GAATAGCTTTCAGGGCGATAA pLKO_005 1970 3UTR 100% 10.800 15.120 N KCNJ3 n/a
2 TRCN0000044330 CCAATGTCTATAACTTCCCTT pLKO.1 455 CDS 100% 2.640 3.696 N KCNJ3 n/a
3 TRCN0000426057 TACGGAGGGAGGACATCATAA pLKO_005 1758 3UTR 100% 13.200 10.560 N KCNJ3 n/a
4 TRCN0000069737 CCCTTTAATAGCACCAGCCAT pLKO.1 1188 CDS 100% 2.640 2.112 N Kcnj3 n/a
5 TRCN0000044328 CCCATGAAACTTCAACGAATA pLKO.1 1381 CDS 100% 10.800 7.560 N KCNJ3 n/a
6 TRCN0000044332 GCTTAGATGGACTAGATGATA pLKO.1 1244 CDS 100% 5.625 3.938 N KCNJ3 n/a
7 TRCN0000044329 CCAGCCATAACTAACAGCAAA pLKO.1 1201 CDS 100% 4.950 3.465 N KCNJ3 n/a
8 TRCN0000069734 GCAGGAGGAAATGCTTCTCAT pLKO.1 1161 CDS 100% 4.950 3.465 N Kcnj3 n/a
9 TRCN0000044331 CCTCACAATTTGCCACGTGAT pLKO.1 882 CDS 100% 4.050 2.835 N KCNJ3 n/a
10 TRCN0000166498 CGCCTGTAATCCCAGTACTTT pLKO.1 3892 3UTR 100% 5.625 2.813 Y MGC13053 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002239.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06476 pDONR223 100% 99.8% 99.6% None 811T>C;871G>A;1038T>C n/a
2 ccsbBroad304_06476 pLX_304 0% 99.8% 99.6% V5 811T>C;871G>A;1038T>C n/a
3 TRCN0000468883 TTGTGATAATGCCGACTGATAATT pLX_317 29.6% 99.8% 99.6% V5 811T>C;871G>A;1038T>C n/a
Download CSV